Human JCHAIN/IGCJ/IGJ ORF/cDNA clone-Lentivirus plasmid (NM_144646.4)

Cat. No.: pGMLV001012
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human JCHAIN/IGCJ/IGJ Lentiviral expression plasmid for JCHAIN lentivirus packaging, JCHAIN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to IGJ/JCHAIN/JCHAIN/IGCJ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV001012
Gene Name JCHAIN
Accession Number NM_144646.4
Gene ID 3512
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 480 bp
Gene Alias IGCJ,IGJ,JCH
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag HA (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGAACCATTTGCTTTTCTGGGGAGTCCTGGCGGTTTTTATTAAGGCTGTTCATGTGAAAGCCCAAGAAGATGAAAGGATTGTTCTTGTTGACAACAAATGTAAGTGTGCCCGGATTACTTCCAGGATCATCCGTTCTTCCGAAGATCCTAATGAGGACATTGTGGAGAGAAACATCCGAATTATTGTTCCTCTGAACAACAGGGAGAATATCTCTGATCCCACCTCACCATTGAGAACCAGATTTGTGTACCATTTGTCTGACCTCTGTAAAAAATGTGATCCTACAGAAGTGGAGCTGGATAATCAGATAGTTACTGCTACCCAGAGCAATATCTGTGATGAAGACAGTGCTACAGAGACCTGCTACACTTATGACAGAAACAAGTGCTACACAGCTGTGGTCCCACTCGTATATGGTGGTGAGACCAAAATGGTGGAAACAGCCTTAACCCCAGATGCCTGCTATCCTGACTAA
ORF Protein Sequence MKNHLLFWGVLAVFIKAVHVKAQEDERIVLVDNKCKCARITSRIIRSSEDPNEDIVERNIRIIVPLNNRENISDPTSPLRTRFVYHLSDLCKKCDPTEVELDNQIVTATQSNICDEDSATETCYTYDRNKCYTAVVPLVYGGETKMVETALTPDACYPD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1043-Ab Anti-IGJ/ JCHAIN/ IGCJ functional antibody
    Target Antigen GM-Tg-g-SE1043-Ag JCHAIN protein
    ORF Viral Vector pGMLV001012 Human JCHAIN Lentivirus plasmid
    ORF Viral Vector vGMLV001012 Human JCHAIN Lentivirus particle


    Target information

    Target ID GM-SE1043
    Target Name IGJ/JCHAIN
    Gene Group Identifier
    （Target Gene ID in Homo species)         		3512
    Gene ID 100629603 (Equus caballus), 101085285 (Felis catus), 16069 (Mus musculus), 280821 (Bos taurus)
    3512 (Homo sapiens), 360922 (Rattus norvegicus), 475166 (Canis lupus familiaris), 706650 (Macaca mulatta)
    Gene Symbols & Synonyms JCHAIN,Jchain,IGJ,Igj,Jch,9530090F24Rik,JCH,IGCJ
    Target Alternative Names 9530090F24Rik,IGCJ,IGJ,Igj,Immunoglobulin J chain,JCH,JCHAIN,Jch,Jchain,Joining chain of multimeric IgA and IgM
    Uniprot Accession P01591,P01592
    Additional SwissProt Accessions: P01592,P01591
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000020041, ENSMUSG00000067149, ENSBTAG00000018531, ENSG00000132465, ENSCAFG00845010824, ENSMMUG00000059785
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.