Human CD274/B7-H/B7H1 ORF/cDNA clone-Lentivirus plasmid (NM_014143.3)

Cat. No.: pGMLV000749
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CD274/B7-H/B7H1 Lentiviral expression plasmid for CD274 lentivirus packaging, CD274 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to PD-L1/CD274/CD274/B7-H products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $518.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000749
Gene Name CD274
Accession Number NM_014143.3
Gene ID 29126
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 873 bp
Gene Alias B7-H,B7H1,PD-L1,PDCD1L1,PDCD1LG1,PDL1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Null
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGATATTTGCTGTCTTTATATTCATGACCTACTGGCATTTGCTGAACGCATTTACTGTCACGGTTCCCAAGGACCTATATGTGGTAGAGTATGGTAGCAATATGACAATTGAATGCAAATTCCCAGTAGAAAAACAATTAGACCTGGCTGCACTAATTGTCTATTGGGAAATGGAGGATAAGAACATTATTCAATTTGTGCATGGAGAGGAAGACCTGAAGGTTCAGCATAGTAGCTACAGACAGAGGGCCCGGCTGTTGAAGGACCAGCTCTCCCTGGGAAATGCTGCACTTCAGATCACAGATGTGAAATTGCAGGATGCAGGGGTGTACCGCTGCATGATCAGCTATGGTGGTGCCGACTACAAGCGAATTACTGTGAAAGTCAATGCCCCATACAACAAAATCAACCAAAGAATTTTGGTTGTGGATCCAGTCACCTCTGAACATGAACTGACATGTCAGGCTGAGGGCTACCCCAAGGCCGAAGTCATCTGGACAAGCAGTGACCATCAAGTCCTGAGTGGTAAGACCACCACCACCAATTCCAAGAGAGAGGAGAAGCTTTTCAATGTGACCAGCACACTGAGAATCAACACAACAACTAATGAGATTTTCTACTGCACTTTTAGGAGATTAGATCCTGAGGAAAACCATACAGCTGAATTGGTCATCCCAGAACTACCTCTGGCACATCCTCCAAATGAAAGGACTCACTTGGTAATTCTGGGAGCCATCTTATTATGCCTTGGTGTAGCACTGACATTCATCTTCCGTTTAAGAAAAGGGAGAATGATGGATGTGAAAAAATGTGGCATCCAAGATACAAACTCAAAGAAGCAAAGTGATACACATTTGGAGGAGACGTAA
ORF Protein Sequence MRIFAVFIFMTYWHLLNAFTVTVPKDLYVVEYGSNMTIECKFPVEKQLDLAALIVYWEMEDKNIIQFVHGEEDLKVQHSSYRQRARLLKDQLSLGNAALQITDVKLQDAGVYRCMISYGGADYKRITVKVNAPYNKINQRILVVDPVTSEHELTCQAEGYPKAEVIWTSSDHQVLSGKTTTTNSKREEKLFNVTSTLRINTTTNEIFYCTFRRLDPEENHTAELVIPELPLAHPPNERTHLVILGAILLCLGVALTFIFRLRKGRMMDVKKCGIQDTNSKKQSDTHLEET

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-422 Pre-Made Pacmilimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-040 Pre-Made Avelumab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-INN-972 Pre-Made Retlirafusp Alfa Biosimilar, Fusion Protein targeting CD274/PD-L1 fused with human TGFBR2 (transforming growth factor beta receptor 2) extracellular fragment (20-136) via a peptidyl linker: Recombinant therapeutic protein targeting B7-H/B7H1/PDCD1L1/PDCD1LG1
    Biosimilar GMP-Bios-ab-034 Pre-Made Atezolizumab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-159 Pre-Made Durvalumab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-534 Pre-Made Sugemalimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-409 Pre-Made Opucolimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-188 Pre-Made Envafolimab biosimilar, Single Domain Variable Fragment;H, Anti-CD274/PD-L1 Antibody: Anti-B7-H, B7H1, PD-L1, PDCD1L1, PDCD1LG1, PDL1, hPD-L1 therapeutic antibody
    Biosimilar GMP-Bios-ab-533 Pre-Made Sudubrilimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-071 Pre-Made Bintrafusp biosimilar, Whole mAb Fusion, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-481 Pre-Made Retlirafusp biosimilar, Whole mAb Fusion, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-698 Pre-Made Tagitanlimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-INN-797 Pre-Made Davoceticept Biosimilar, Fusion Protein targeting CD274/PD-L1 fused with human IGHG1 Fc (Fragment constant) via a peptidyl linker: Recombinant therapeutic protein targeting B7-H/B7H1/PDCD1L1/PDCD1LG1
    Biosimilar GMP-Bios-ab-121 Pre-Made Cosibelimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-INN-762 Pre-Made Bintrafusp Alfa Biosimilar, Fusion Protein targeting CD274/PD-L1 fused with human TGFBR2 (transforming growth factor beta receptor 2) (1:2) via a peptidyl linker: Recombinant therapeutic protein targeting B7-H/B7H1/PDCD1L1/PDCD1LG1
    Biosimilar GMP-Bios-ab-317 Pre-Made Lodapolimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-194 Pre-Made Erfonrilimab biosimilar, Bispecific Single Domains (VH-VH'-CH), Anti-CD274/PD-L1;CTLA4/CTLA-4 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1;CD/GSE/GRD4/ALPS5/CD152/IDDM12/CELIAC3 therapeutic antibody
    Biosimilar GMP-Bios-ab-010 Pre-Made Adebrelimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-693 Pre-Made Simridarlimab biosimilar, Whole mAb, Anti-CD47;CD274/PD-L1 Antibody: Anti-IAP/OA3/MER6;B7-H/B7H1/PD-L1/PDCD1L1/PDCD1LG1/PDL1/hPD-L1 therapeutic antibody
    Biosimilar GMP-Bios-ab-235 Pre-Made Garivulimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-695 Pre-Made Socazolimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Biosimilar GMP-Bios-ab-007 Pre-Made Acasunlimab biosimilar, Bispecific mAb, Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1/PDL1/hPD-L1;ILA/4-1BB/CDw137 Antibod: Anti-CD274/PD-L1;TNFRSF9/CD137 therapeutic antibody
    Biosimilar GMP-Bios-ab-334 Pre-Made Manelimab biosimilar, Whole mAb, Anti-CD274/PD-L1 Antibody: Anti-B7-H/B7H1/PDCD1L1/PDCD1LG1 therapeutic antibody
    Target Antibody GM-Tg-g-T99948-Ab Anti-PD1L1/ PD-L1/ CD274 monoclonal antibody
    Target Antigen GM-Tg-g-T99948-Ag PD-L1/CD274 VLP (virus-like particle)
    ORF Viral Vector pGMLV000121 Human CD274 Lentivirus plasmid
    ORF Viral Vector pGMLV000710 Human CD274 Lentivirus plasmid
    ORF Viral Vector pGMLV000749 Human CD274 Lentivirus plasmid
    ORF Viral Vector pGMLV001704 Human CD274 Lentivirus plasmid
    ORF Viral Vector pGMLV001797 Human CD274 Lentivirus plasmid
    ORF Viral Vector pGMLV001918 Human CD274 Lentivirus plasmid
    ORF Viral Vector pGMLV002461 Human CD274 Lentivirus plasmid
    ORF Viral Vector pGMLV002726 Human CD274 Lentivirus plasmid
    ORF Viral Vector pGMAD001278 Human CD274 Adenovirus plasmid
    ORF Viral Vector pGMPC000014 Human CD274 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000459 Human CD274 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000807 Human CD274 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001107 Human CD274 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000121 Human CD274 Lentivirus particle
    ORF Viral Vector vGMLV000710 Human CD274 Lentivirus particle
    ORF Viral Vector vGMLV000749 Human CD274 Lentivirus particle
    ORF Viral Vector vGMLV001704 Human CD274 Lentivirus particle
    ORF Viral Vector vGMLV001797 Human CD274 Lentivirus particle
    ORF Viral Vector vGMLV001918 Human CD274 Lentivirus particle
    ORF Viral Vector vGMLV002461 Human CD274 Lentivirus particle
    ORF Viral Vector vGMLV002726 Human CD274 Lentivirus particle
    ORF Viral Vector vGMAD001278 Human CD274 Adenovirus particle


    Target information

    Target ID GM-T99948
    Target Name PD-L1/CD274
    Gene Group Identifier
    (Target Gene ID in Homo species)
    29126
    Gene ID 100051703 (Equus caballus), 100127110 (Felis catus), 29126 (Homo sapiens), 484186 (Canis lupus familiaris)
    499342 (Rattus norvegicus), 533834 (Bos taurus), 60533 (Mus musculus), 716043 (Macaca mulatta)
    Gene Symbols & Synonyms CD274,Cd274,PD-L1,B7-H,B7H1,PDL1,hPD-L1,PDCD1L1,PDCD1LG1,Pdcd1lg1,RGD1566211,B7h1,Pdl1,Pdcd1l1,A530045L16Rik
    Target Alternative Names A530045L16Rik,B7 homolog 1 (B7-H1),B7-H,B7H1,B7h1,CD274,Cd274,PD-L1,PDCD1 ligand 1,PDCD1L1,PDCD1LG1,PDL1,Pdcd1l1,Pdcd1lg1,Pdl1,Programmed cell death 1 ligand 1,Programmed death ligand 1,RGD1566211,hPD-L1
    Uniprot Accession Q9EP73,Q9NZQ7
    Additional SwissProt Accessions: Q9NZQ7,Q9EP73
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index
    Disease cancer
    Disease from KEGG Cell adhesion molecules, PD-L1 expression and PD-1 checkpoint pathway in cancer
    Gene Ensembl ENSECAG00000016312, ENSG00000120217, ENSCAFG00845016107, ENSBTAG00000000095, ENSMUSG00000016496, ENSMMUG00000012235
    Target Classification Checkpoint-Immuno Oncology, Cytokine Receptor, Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.