Human IDH1/HEL-216/HEL-S-26 ORF/cDNA clone-Lentivirus plasmid (NM_005896.3)

Cat. No.: pGMLV000644
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human IDH1/HEL-216/HEL-S-26 Lentiviral expression plasmid for IDH1 lentivirus packaging, IDH1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to IDH1/HEL-216 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $648.6
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000644
Gene Name IDH1
Accession Number NM_005896.3
Gene ID 3417
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1245 bp
Gene Alias HEL-216,HEL-S-26,IDCD,IDH,IDP,IDPC,PICD
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCCAAAAAAATCAGTGGCGGTTCTGTGGTAGAGATGCAAGGAGATGAAATGACACGAATCATTTGGGAATTGATTAAAGAGAAACTCATTTTTCCCTACGTGGAATTGGATCTACATAGCTATGATTTAGGCATAGAGAATCGTGATGCCACCAACGACCAAGTCACCAAGGATGCTGCAGAAGCTATAAAGAAGCATAATGTTGGCGTCAAATGTGCCACTATCACTCCTGATGAGAAGAGGGTTGAGGAGTTCAAGTTGAAACAAATGTGGAAATCACCAAATGGCACCATACGAAATATTCTGGGTGGCACGGTCTTCAGAGAAGCCATTATCTGCAAAAATATCCCCCGGCTTGTGAGTGGATGGGTAAAACCTATCATCATAGGTCGTCATGCTTATGGGGATCAATACAGAGCAACTGATTTTGTTGTTCCTGGGCCTGGAAAAGTAGAGATAACCTACACACCAAGTGACGGAACCCAAAAGGTGACATACCTGGTACATAACTTTGAAGAAGGTGGTGGTGTTGCCATGGGGATGTATAATCAAGATAAGTCAATTGAAGATTTTGCACACAGTTCCTTCCAAATGGCTCTGTCTAAGGGTTGGCCTTTGTATCTGAGCACCAAAAACACTATTCTGAAGAAATATGATGGGCGTTTTAAAGACATCTTTCAGGAGATATATGACAAGCAGTACAAGTCCCAGTTTGAAGCTCAAAAGATCTGGTATGAGCATAGGCTCATCGACGACATGGTGGCCCAAGCTATGAAATCAGAGGGAGGCTTCATCTGGGCCTGTAAAAACTATGATGGTGACGTGCAGTCGGACTCTGTGGCCCAAGGGTATGGCTCTCTCGGCATGATGACCAGCGTGCTGGTTTGTCCAGATGGCAAGACAGTAGAAGCAGAGGCTGCCCACGGGACTGTAACCCGTCACTACCGCATGTACCAGAAAGGACAGGAGACGTCCACCAATCCCATTGCTTCCATTTTTGCCTGGACCAGAGGGTTAGCCCACAGAGCAAAGCTTGATAACAATAAAGAGCTTGCCTTCTTTGCAAATGCTTTGGAAGAAGTCTCTATTGAGACAATTGAGGCTGGCTTCATGACCAAGGACTTGGCTGCTTGCATTAAAGGTTTACCCAATGTGCAACGTTCTGACTACTTGAATACATTTGAGTTCATGGATAAACTTGGAGAAAACTTGAAGATCAAACTAGCTCAGGCCAAACTTTAA
ORF Protein Sequence MSKKISGGSVVEMQGDEMTRIIWELIKEKLIFPYVELDLHSYDLGIENRDATNDQVTKDAAEAIKKHNVGVKCATITPDEKRVEEFKLKQMWKSPNGTIRNILGGTVFREAIICKNIPRLVSGWVKPIIIGRHAYGDQYRATDFVVPGPGKVEITYTPSDGTQKVTYLVHNFEEGGGVAMGMYNQDKSIEDFAHSSFQMALSKGWPLYLSTKNTILKKYDGRFKDIFQEIYDKQYKSQFEAQKIWYEHRLIDDMVAQAMKSEGGFIWACKNYDGDVQSDSVAQGYGSLGMMTSVLVCPDGKTVEAEAAHGTVTRHYRMYQKGQETSTNPIASIFAWTRGLAHRAKLDNNKELAFFANALEEVSIETIEAGFMTKDLAACIKGLPNVQRSDYLNTFEFMDKLGENLKIKLAQAKL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T69563-Ab Anti-IDH1 monoclonal antibody
    Target Antigen GM-Tg-g-T69563-Ag IDH1 protein
    ORF Viral Vector pGMLV000343 Human IDH1 Lentivirus plasmid
    ORF Viral Vector pGMLV000344 Human IDH1 Lentivirus plasmid
    ORF Viral Vector pGMLV000345 Human IDH1 Lentivirus plasmid
    ORF Viral Vector pGMLV000644 Human IDH1 Lentivirus plasmid
    ORF Viral Vector pGMLV001085 Human IDH1 Lentivirus plasmid
    ORF Viral Vector pGMLV001957 Human IDH1 Lentivirus plasmid
    ORF Viral Vector pGMLV002527 Human IDH1 Lentivirus plasmid
    ORF Viral Vector pGMAD000601 Human IDH1 Adenovirus plasmid
    ORF Viral Vector pGMPC000259 Human IDH1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC000260 Human IDH1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC004929 Human IDH1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000343 Human IDH1 Lentivirus particle
    ORF Viral Vector vGMLV000344 Human IDH1 Lentivirus particle
    ORF Viral Vector vGMLV000345 Human IDH1 Lentivirus particle
    ORF Viral Vector vGMLV000644 Human IDH1 Lentivirus particle
    ORF Viral Vector vGMLV001085 Human IDH1 Lentivirus particle
    ORF Viral Vector vGMLV001957 Human IDH1 Lentivirus particle
    ORF Viral Vector vGMLV002527 Human IDH1 Lentivirus particle
    ORF Viral Vector vGMAD000601 Human IDH1 Adenovirus particle


    Target information

    Target ID GM-T69563
    Target Name IDH1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    3417
    Gene ID 100066416 (Equus caballus), 15926 (Mus musculus), 24479 (Rattus norvegicus), 281235 (Bos taurus)
    3417 (Homo sapiens), 478889 (Canis lupus familiaris), 710019 (Macaca mulatta), 751618 (Felis catus)
    Gene Symbols & Synonyms IDH1,Idh1,Id-1,Idpc,Idh-1,E030024J03Rik,IDPc,IDH,IDP,IDCD,IDPC,PICD,HEL-216,HEL-S-26
    Target Alternative Names Cytosolic NADP-isocitrate dehydrogenase,E030024J03Rik,HEL-216,HEL-S-26,IDCD,IDH,IDH1,IDP,IDPC,IDPc,Id-1,Idh-1,Idh1,Idpc,Isocitrate dehydrogenase [NADP] cytoplasmic,NADP(+)-specific ICDH,Oxalosuccinate decarboxylase,PICD
    Uniprot Accession O75874,O88844,P41562,Q9XSG3
    Additional SwissProt Accessions: O88844,P41562,Q9XSG3,O75874
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease cancer, Ovary Cancer
    Disease from KEGG Metabolic pathways, Central carbon metabolism in cancer
    Gene Ensembl ENSMUSG00000025950, ENSBTAG00000020527, ENSG00000138413, ENSCAFG00845023478, ENSMMUG00000016077
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.