Click here to discover the largest collection of GeneMedi's Promise-ORF™ ORF/cDNA expression clones
Plasmid quantity:
- 10mg, 50mg, 100mg, 500mg, >1g
Talk to our Expert:
- • Research Grade
- • Endotoxin-Free Grade
- • High Quality (HQ) Grade
TECHNICAL RESOURCE
Supports
- Talk to our Expert:
[email protected]
Protocol Library Download
 |
 |
Human IGF2/C11orf43/GRDF ORF/cDNA clone-Lentivirus plasmid (NM_001127598.2)
Cat. No.: pGMLV000475
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human IGF2/C11orf43/GRDF Lentiviral expression plasmid for IGF2 lentivirus packaging, IGF2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Datasheet
Go to
IGF2/C11orf43 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV000475 |
| Gene Name | IGF2 |
| Accession Number | NM_001127598.2 |
| Gene ID | 3481 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 711 bp |
| Gene Alias | C11orf43,GRDF,IGF-II,PP9974 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGTTTCCCCAGACCCCCAAATTATCGTGGTGGCCCCCGAGACCGAACTCGCGTCTATGCAAGTCCAACGCACTGAGGACGGGGTAACCATTATCCAGATATTTTGGGTGGGCCGCAAAGGCGAGCTACTTAGACGCACCCCGGTGAGCTCGGCCATGCAGACACCAATGGGAATCCCAATGGGGAAGTCGATGCTGGTGCTTCTCACCTTCTTGGCCTTCGCCTCGTGCTGCATTGCTGCTTACCGCCCCAGTGAGACCCTGTGCGGCGGGGAGCTGGTGGACACCCTCCAGTTCGTCTGTGGGGACCGCGGCTTCTACTTCAGCAGGCCCGCAAGCCGTGTGAGCCGTCGCAGCCGTGGCATCGTTGAGGAGTGCTGTTTCCGCAGCTGTGACCTGGCCCTCCTGGAGACGTACTGTGCTACCCCCGCCAAGTCCGAGAGGGACGTGTCGACCCCTCCGACCGTGCTTCCGGACAACTTCCCCAGATACCCCGTGGGCAAGTTCTTCCAATATGACACCTGGAAGCAGTCCACCCAGCGCCTGCGCAGGGGCCTGCCTGCCCTCCTGCGTGCCCGCCGGGGTCACGTGCTCGCCAAGGAGCTCGAGGCGTTCAGGGAGGCCAAACGTCACCGTCCCCTGATTGCTCTACCCACCCAAGACCCCGCCCACGGGGGCGCCCCCCCAGAGATGGCCAGCAATCGGAAGTGA |
| ORF Protein Sequence | MVSPDPQIIVVAPETELASMQVQRTEDGVTIIQIFWVGRKGELLRRTPVSSAMQTPMGIPMGKSMLVLLTFLAFASCCIAAYRPSETLCGGELVDTLQFVCGDRGFYFSRPASRVSRRSRGIVEECCFRSCDLALLETYCATPAKSERDVSTPPTVLPDNFPRYPVGKFFQYDTWKQSTQRLRRGLPALLRARRGHVLAKELEAFREAKRHRPLIALPTQDPAHGGAPPEMASNRK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-ab-634 | Pre-Made Xentuzumab biosimilar, Whole mAb, Anti-IGF1;IGF2 Antibody: Anti-IGF/IGF-I/IGFI/MGF;C11orf43/GRDF/IGF-II/PP9974/SRS3 therapeutic antibody |
| Biosimilar | GMP-Bios-ab-160 | Pre-Made Dusigitumab biosimilar, Whole mAb, Anti-IGF1;IGF2 Antibody: Anti-IGF/IGF-I/IGFI/MGF;C11orf43/GRDF/IGF-II/PP9974/SRS3 therapeutic antibody |
| Target Antibody | GM-Tg-g-T90572-Ab | Anti-IGF2/ C11orf43/ GRDF functional antibody |
| Target Antigen | GM-Tg-g-T90572-Ag | IGF2 protein |
| Cytokine | cks-Tg-g-GM-T90572 | insulin-like growth factor 2 (IGF2) protein & antibody |
| ORF Viral Vector | pGMLV000393 | Human IGF2 Lentivirus plasmid |
| ORF Viral Vector | pGMLV000475 | Human IGF2 Lentivirus plasmid |
| ORF Viral Vector | pGMAP000466 | Human IGF2 Adenovirus plasmid |
| ORF Viral Vector | vGMLV000393 | Human IGF2 Lentivirus particle |
| ORF Viral Vector | vGMLV000475 | Human IGF2 Lentivirus particle |
| ORF Viral Vector | vGMAP000466 | Human IGF2 Adenovirus particle |
Target information
| Target ID | GM-T90572 |
| Target Name | IGF2 |
|
Gene Group Identifier （Target Gene ID in Homo species) |
3481 |
| Gene ID |
100034182 (Equus caballus), 101093644 (Felis catus), 16002 (Mus musculus), 24483 (Rattus norvegicus) 281240 (Bos taurus), 3481 (Homo sapiens), 483664 (Canis lupus familiaris), 710802 (Macaca mulatta) |
| Gene Symbols & Synonyms | IGF2,Igf2,IGF-II,Mpr,M6pr,Peg2,Igf-2,Igf-II,IGFII,RNIGF2,GRDF,SRS3,PP9974,C11orf43 |
| Target Alternative Names | C11orf43,GRDF,IGF-II,IGF2,IGFII,Igf-2,Igf-II,Igf2,Insulin-like growth factor 2,Insulin-like growth factor II (IGF-II),M6pr,Mpr,PP9974,Peg2,RNIGF2,SRS3,Somatomedin-A,T3M-11-derived growth factor |
| Uniprot Accession |
P01344,P01346,P07456,P09535,P51459
Additional SwissProt Accessions: P51459,P09535,P01346,P07456,P01344 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, INN Index, Cytokine Target |
| Disease | cancer, Ovary Cancer |
| Disease from KEGG | MAPK signaling pathway, Ras signaling pathway, PI3K-Akt signaling pathway, Pathways in cancer, Proteoglycans in cancer, Hepatocellular carcinoma |
| Gene Ensembl | ENSECAG00000028346, ENSMUSG00000048583, ENSBTAG00000013066, ENSG00000167244, ENSCAFG00845011017, ENSMMUG00000047449 |
| Target Classification |
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.