Human CD40LG/CD154/CD40L ORF/cDNA clone-Lentivirus plasmid (NM_000074)

Cat. No.: pGMLV000459
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CD40LG/CD154/CD40L Lentiviral expression plasmid for CD40LG lentivirus packaging, CD40LG lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CD40LG/CD154/CD40LG/CD154 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $496.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000459
Gene Name CD40LG
Accession Number NM_000074
Gene ID 959
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 786 bp
Gene Alias CD154,CD40L,gp39,hCD40L,HIGM1,IGM,IMD3,T-BAM,TNFSF5,TRAP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGATCGAAACATACAACCAAACTTCTCCCCGATCTGCGGCCACTGGACTGCCCATCAGCATGAAAATTTTTATGTATTTACTTACTGTTTTTCTTATCACCCAGATGATTGGGTCAGCACTTTTTGCTGTGTATCTTCATAGAAGGTTGGACAAGATAGAAGATGAAAGGAATCTTCATGAAGATTTTGTATTCATGAAAACGATACAGAGATGCAACACAGGAGAAAGATCCTTATCCTTACTGAACTGTGAGGAGATTAAAAGCCAGTTTGAAGGCTTTGTGAAGGATATAATGTTAAACAAAGAGGAGACGAAGAAAGAAAACAGCTTTGAAATGCAAAAAGGTGATCAGAATCCTCAAATTGCGGCACATGTCATAAGTGAGGCCAGCAGTAAAACAACATCTGTGTTACAGTGGGCTGAAAAAGGATACTACACCATGAGCAACAACTTGGTAACCCTGGAAAATGGGAAACAGCTGACCGTTAAAAGACAAGGACTCTATTATATCTATGCCCAAGTCACCTTCTGTTCCAATCGGGAAGCTTCGAGTCAAGCTCCATTTATAGCCAGCCTCTGCCTAAAGTCCCCCGGTAGATTCGAGAGAATCTTACTCAGAGCTGCAAATACCCACAGTTCCGCCAAACCTTGCGGGCAACAATCCATTCACTTGGGAGGAGTATTTGAATTGCAACCAGGTGCTTCGGTGTTTGTCAATGTGACTGATCCAAGCCAAGTGAGCCATGGCACTGGCTTCACGTCCTTTGGCTTACTCAAACTCTGA
ORF Protein Sequence MIETYNQTSPRSAATGLPISMKIFMYLLTVFLITQMIGSALFAVYLHRRLDKIEDERNLHEDFVFMKTIQRCNTGERSLSLLNCEEIKSQFEGFVKDIMLNKEETKKENSFEMQKGDQNPQIAAHVISEASSKTTSVLQWAEKGYYTMSNNLVTLENGKQLTVKRQGLYYIYAQVTFCSNREASSQAPFIASLCLKSPGRFERILLRAANTHSSAKPCGQQSIHLGGVFELQPGASVFVNVTDPSQVSHGTGFTSFGLLKL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-132 Pre-Made Dapirolizumab biosimilar, Fab, Anti-CD40LG Antibody: Anti-IGM/IMD3/TRAP/gp39/CD154/CD40L/HIGM1/T-BAM/TNFSF5/hCD40L therapeutic antibody
    Biosimilar GMP-Bios-ab-501 Pre-Made Ruplizumab biosimilar, Whole mAb, Anti-CD40LG Antibody: Anti-IGM/IMD3/TRAP/gp39/CD154/CD40L/HIGM1/T-BAM/TNFSF5/hCD40L therapeutic antibody
    Biosimilar GMP-Bios-INN-1026 Pre-Made Toralizumab Biosimilar, Whole Mab, Anti-Cd40Lg Antibody: Anti-CD154/CD40L/HIGM1/IGM/IMD3/T-BAM/TNFSF5/TRAP/gp39/hCD40L therapeutic antibody
    Biosimilar GMP-Bios-INN-798 Pre-Made Dazodalibep Biosimilar, Fusion Protein targeting CD40LG fused with ALB (albumin, human serum albumin, HSA): Recombinant therapeutic protein targeting CD154/CD40L/HIGM1/IGM/IMD3/T-BAM/TNFSF5/TRAP/gp39/hCD40L
    Biosimilar GMP-Bios-ab-307 Pre-Made Letolizumab biosimilar, Single Domain Variable Fragment;H, Anti-CD40LG Antibody: Anti-IGM/IMD3/TRAP/gp39/CD154/CD40L/HIGM1/T-BAM/TNFSF5/hCD40L therapeutic antibody
    Target Antibody GM-Tg-g-T14755-Ab Anti-CD40L/ CD40LG/ CD154 monoclonal antibody
    Target Antigen GM-Tg-g-T14755-Ag CD40LG VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T14755 CD40 ligand (CD154) protein & antibody
    ORF Viral Vector pGMLV000459 Human CD40LG Lentivirus plasmid
    ORF Viral Vector pGMAP000295 Human CD40LG Adenovirus plasmid
    ORF Viral Vector vGMLV000459 Human CD40LG Lentivirus particle
    ORF Viral Vector vGMAP000295 Human CD40LG Adenovirus particle


    Target information

    Target ID GM-T14755
    Target Name CD40LG/CD154
    Gene Group Identifier
    （Target Gene ID in Homo species)         		959
    Gene ID 100054624 (Equus caballus), 21947 (Mus musculus), 403468 (Canis lupus familiaris), 493850 (Felis catus)
    574160 (Macaca mulatta), 84349 (Rattus norvegicus), 959 (Homo sapiens)
    Gene Symbols & Synonyms CD40LG,Cd40lg,cd154,TNLG8B,IGM,IMD3,Ly62,TRAP,gp39,CD154,Cd40l,HIGM1,Ly-62,T-BAM,CD40-L,Tnfsf5,Tnlg8b,TNFSF5,CD40L,hCD40L
    Target Alternative Names CD154,CD40 ligand,CD40-L,CD40L,CD40LG,Cd40l,Cd40lg,HIGM1,IGM,IMD3,Ly-62,Ly62,T-BAM,T-cell antigen Gp39,TNF-related activation protein (TRAP),TNFSF5,TNLG8B,TRAP,Tnfsf5,Tnlg8b,Tumor necrosis factor ligand superfamily member 5,cd154,gp39,hCD40L
    Uniprot Accession O97605,O97626,P27548,P29965,P63304,Q9Z2V2
    Additional SwissProt Accessions: P27548,O97626,O97605,P63304,Q9Z2V2,P29965
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease
    Disease from KEGG Cytokine-cytokine receptor interaction, NF-kappa B signaling pathway, Cell adhesion molecules, T cell receptor signaling pathway, Intestinal immune network for IgA production, Malaria, Toxoplasmosis, Asthma, Autoimmune thyroid disease, Allograft rejection, Viral myocarditis, Lipid and atherosclerosis
    Gene Ensembl ENSECAG00000011392, ENSMUSG00000031132, ENSCAFG00845029290, ENSMMUG00000013773, ENSG00000102245
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.