Human FUT3/CD174/FT3B ORF/cDNA clone-Lentivirus plasmid (NM_000149)

Cat. No.: pGMLV000456
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FUT3/CD174/FT3B Lentiviral expression plasmid for FUT3 lentivirus packaging, FUT3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to FUT3/CD174 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $604.08
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000456
Gene Name FUT3
Accession Number NM_000149
Gene ID 2525
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1086 bp
Gene Alias CD174,FT3B,FucT-III,LE,Les
Fluorescent Reporter Firefly luciferase
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGATCCCCTGGGTGCAGCCAAGCCACAATGGCCATGGCGCCGCTGTCTGGCCGCACTGCTATTTCAGCTGCTGGTGGCTGTGTGTTTCTTCTCCTACCTGCGTGTGTCCCGAGACGATGCCACTGGATCCCCTAGGGCTCCCAGTGGGTCCTCCCGACAGGACACCACTCCCACCCGCCCCACCCTCCTGATCCTGCTATGGACATGGCCTTTCCACATCCCTGTGGCTCTGTCCCGCTGTTCAGAGATGGTGCCCGGCACAGCCGACTGCCACATCACTGCCGACCGCAAGGTGTACCCACAGGCAGACACGGTCATCGTGCACCACTGGGATATCATGTCCAACCCTAAGTCACGCCTCCCACCTTCCCCGAGGCCGCAGGGGCAGCGCTGGATCTGGTTCAACTTGGAGCCACCCCCTAACTGCCAGCACCTGGAAGCCCTGGACAGATACTTCAATCTCACCATGTCCTACCGCAGCGACTCCGACATCTTCACGCCCTACGGCTGGCTGGAGCCGTGGTCCGGCCAGCCTGCCCACCCACCGCTCAACCTCTCGGCCAAGACCGAGCTGGTGGCCTGGGCGGTGTCCAACTGGAAGCCGGACTCAGCCAGGGTGCGCTACTACCAGAGCCTGCAGGCTCATCTCAAGGTGGACGTGTACGGACGCTCCCACAAGCCCCTGCCCAAGGGGACCATGATGGAGACGCTGTCCCGGTACAAGTTCTACCTGGCCTTCGAGAACTCCTTGCACCCCGACTACATCACCGAGAAGCTGTGGAGGAACGCCCTGGAGGCCTGGGCCGTGCCCGTGGTGCTGGGCCCCAGCAGAAGCAACTACGAGAGGTTCCTGCCACCCGACGCCTTCATCCACGTGGACGACTTCCAGAGCCCCAAGGACCTGGCCCGGTACCTGCAGGAGCTGGACAAGGACCACGCCCGCTACCTGAGCTACTTTCGCTGGCGGGAGACGCTGCGGCCTCGCTCCTTCAGCTGGGCACTGGATTTCTGCAAGGCCTGCTGGAAACTGCAGCAGGAATCCAGGTACCAGACGGTGCGCAGCATAGCGGCTTGGTTCACCTGA
ORF Protein Sequence MDPLGAAKPQWPWRRCLAALLFQLLVAVCFFSYLRVSRDDATGSPRAPSGSSRQDTTPTRPTLLILLWTWPFHIPVALSRCSEMVPGTADCHITADRKVYPQADTVIVHHWDIMSNPKSRLPPSPRPQGQRWIWFNLEPPPNCQHLEALDRYFNLTMSYRSDSDIFTPYGWLEPWSGQPAHPPLNLSAKTELVAWAVSNWKPDSARVRYYQSLQAHLKVDVYGRSHKPLPKGTMMETLSRYKFYLAFENSLHPDYITEKLWRNALEAWAVPVVLGPSRSNYERFLPPDAFIHVDDFQSPKDLARYLQELDKDHARYLSYFRWRETLRPRSFSWALDFCKACWKLQQESRYQTVRSIAAWFT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0076-Ab Anti-FUT3 monoclonal antibody
    Target Antigen GM-Tg-g-IP0076-Ag FUT3 protein
    ORF Viral Vector pGMLP003593 Human FUT3 Lentivirus plasmid
    ORF Viral Vector pGMLV000456 Human FUT3 Lentivirus plasmid
    ORF Viral Vector vGMLP003593 Human FUT3 Lentivirus particle
    ORF Viral Vector vGMLV000456 Human FUT3 Lentivirus particle


    Target information

    Target ID GM-IP0076
    Target Name FUT3
    Gene Group Identifier
    (Target Gene ID in Homo species)
    2525
    Gene ID 2525 (Homo sapiens)
    Gene Symbols & Synonyms FUT3,LE,Les,FT3B,CD174,FucT-III
    Target Alternative Names 3-galactosyl-N-acetylglucosaminide 4-alpha-L-fucosyltransferase FUT3,4-galactosyl-N-acetylglucosaminide 3-alpha-L-fucosyltransferase,Alpha-3-fucosyltransferase FUT3,Blood group Lewis alpha-4-fucosyltransferase (Lewis FT),CD174,FT3B,FUT3,FucT-III,Fucosyltransferase 3,Fucosyltransferase III (FucT-III),LE,Les
    Uniprot Accession P21217
    Additional SwissProt Accessions: P21217
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease
    Disease from KEGG Metabolic pathways, Glycosphingolipid biosynthesis - lacto and neolacto series
    Gene Ensembl ENSG00000171124
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.