Human AKT2/HIHGHH/PKBB ORF/cDNA clone-Lentivirus plasmid (NM_001243027.2)

Cat. No.: pGMLV000359
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human AKT2/HIHGHH/PKBB Lentiviral expression plasmid for AKT2 lentivirus packaging, AKT2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to AKT2/HIHGHH products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $652.8
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000359
Gene Name AKT2
Accession Number NM_001243027.2
Gene ID 208
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1260 bp
Gene Alias HIHGHH,PKBB,PKBBETA,PRKBB,RAC-BETA
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGACCGAGAGGCCGCGACCCAACACCTTTGTCATACGCTGCCTGCAGTGGACCACAGTCATCGAGAGGACCTTCCACGTGGATTCTCCAGACGAGAGGGAGGAGTGGATGCGGGCCATCCAGATGGTCGCCAACAGCCTCAAGCAGCGGGCCCCAGGCGAGGACCCCATGGACTACAAGTGTGGCTCCCCCAGTGACTCCTCCACGACTGAGGAGATGGAAGTGGCGGTCAGCAAGGCACGGGCTAAAGTGACCATGAATGACTTCGACTATCTCAAACTCCTTGGCAAGGGAACCTTTGGCAAAGTCATCCTGGTGCGGGAGAAGGCCACTGGCCGCTACTACGCCATGAAGATCCTGCGGAAGGAAGTCATCATTGCCAAGGATGAAGTCGCTCACACAGTCACCGAGAGCCGGGTCCTCCAGAACACCAGGCACCCGTTCCTCACTGCGCTGAAGTATGCCTTCCAGACCCACGACCGCCTGTGCTTTGTGATGGAGTATGCCAACGGGGGTGAGCTGTTCTTCCACCTGTCCCGGGAGCGTGTCTTCACAGAGGAGCGGGCCCGGTTTTATGGTGCAGAGATTGTCTCGGCTCTTGAGTACTTGCACTCGCGGGACGTGGTATACCGCGACATCAAGCTGGAAAACCTCATGCTGGACAAAGATGGCCACATCAAGATCACTGACTTTGGCCTCTGCAAAGAGGGCATCAGTGACGGGGCCACCATGAAAACCTTCTGTGGGACCCCGGAGTACCTGGCGCCTGAGGTGCTGGAGGACAATGACTATGGCCGGGCCGTGGACTGGTGGGGGCTGGGTGTGGTCATGTACGAGATGATGTGCGGCCGCCTGCCCTTCTACAACCAGGACCACGAGCGCCTCTTCGAGCTCATCCTCATGGAAGAGATCCGCTTCCCGCGCACGCTCAGCCCCGAGGCCAAGTCCCTGCTTGCTGGGCTGCTTAAGAAGGACCCCAAGCAGAGGCTTGGTGGGGGGCCCAGCGATGCCAAGGAGGTCATGGAGCACAGGTTCTTCCTCAGCATCAACTGGCAGGACGTGGTCCAGAAGAAGCTCCTGCCACCCTTCAAACCTCAGGTCACGTCCGAGGTCGACACAAGGTACTTCGATGATGAATTTACCGCCCAGTCCATCACAATCACACCCCCTGACCGCTATGACAGCCTGGGCTTACTGGAGCTGGACCAGCGGACCCACTTCCCCCAGTTCTCCTACTCGGCCAGCATCCGCGAGTGA
ORF Protein Sequence MKTERPRPNTFVIRCLQWTTVIERTFHVDSPDEREEWMRAIQMVANSLKQRAPGEDPMDYKCGSPSDSSTTEEMEVAVSKARAKVTMNDFDYLKLLGKGTFGKVILVREKATGRYYAMKILRKEVIIAKDEVAHTVTESRVLQNTRHPFLTALKYAFQTHDRLCFVMEYANGGELFFHLSRERVFTEERARFYGAEIVSALEYLHSRDVVYRDIKLENLMLDKDGHIKITDFGLCKEGISDGATMKTFCGTPEYLAPEVLEDNDYGRAVDWWGLGVVMYEMMCGRLPFYNQDHERLFELILMEEIRFPRTLSPEAKSLLAGLLKKDPKQRLGGGPSDAKEVMEHRFFLSINWQDVVQKKLLPPFKPQVTSEVDTRYFDDEFTAQSITITPPDRYDSLGLLELDQRTHFPQFSYSASIRE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T94621-Ab Anti-AKT2 monoclonal antibody
    Target Antigen GM-Tg-g-T94621-Ag AKT2 protein
    ORF Viral Vector pGMLP005607 Human AKT2 Lentivirus plasmid
    ORF Viral Vector pGMLV000359 Human AKT2 Lentivirus plasmid
    ORF Viral Vector vGMLP005607 Human AKT2 Lentivirus particle
    ORF Viral Vector vGMLV000359 Human AKT2 Lentivirus particle


    Target information

    Target ID GM-T94621
    Target Name AKT2
    Gene Group Identifier
    (Target Gene ID in Homo species)
    208
    Gene ID 100064671 (Equus caballus), 100499544 (Felis catus), 11652 (Mus musculus), 208 (Homo sapiens)
    25233 (Rattus norvegicus), 449021 (Canis lupus familiaris), 534923 (Bos taurus), 700591 (Macaca mulatta)
    Gene Symbols & Synonyms AKT2,Akt2,PKB,PKBbeta,2410016A19Rik,PKBB,PRKBB,HIHGHH,PKBBETA,RAC-BETA
    Target Alternative Names 2410016A19Rik,AKT2,Akt2,HIHGHH,PKB,PKBB,PKBBETA,PKBbeta,PRKBB,Protein kinase Akt-2,Protein kinase B beta (PKB beta),RAC protein kinase beta (RAC-PK-beta),RAC-BETA,RAC-beta serine/threonine-protein kinase
    Uniprot Accession P31751,P47197,Q60823
    Additional SwissProt Accessions: Q60823,P31751,P47197
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG EGFR tyrosine kinase inhibitor resistance, Endocrine resistance, MAPK signaling pathway, ErbB signaling pathway, Ras signaling pathway, Rap1 signaling pathway, cGMP-PKG signaling pathway, cAMP signaling pathway, Chemokine signaling pathway, HIF-1 signaling pathway, FoxO signaling pathway, Sphingolipid signaling pathway, Phospholipase D signaling pathway, PI3K-Akt signaling pathway, Apoptosis, Longevity regulating pathway, Longevity regulating pathway - multiple species, Cellular senescence, Adrenergic signaling in cardiomyocytes, Osteoclast differentiation, Focal adhesion, Signaling pathways regulating pluripotency of stem cells, Platelet activation, Toll-like receptor signaling pathway, C-type lectin receptor signaling pathway, JAK-STAT signaling pathway, T cell receptor signaling pathway, B cell receptor signaling pathway, Fc epsilon RI signaling pathway, TNF signaling pathway, Neurotrophin signaling pathway, Cholinergic synapse, Prolactin signaling pathway, Thyroid hormone signaling pathway, Adipocytokine signaling pathway, Regulation of lipolysis in adipocytes, Relaxin signaling pathway, GnRH secretion, Insulin resistance, AGE-RAGE signaling pathway in diabetic complications, Growth hormone synthesis, secretion and action, Alcoholic liver disease, Carbohydrate digestion and absorption, Alzheimer disease, Yersinia infection, Chagas disease, Toxoplasmosis, Tuberculosis, Hepatitis C, Hepatitis B, Measles, Human cytomegalovirus infection, Influenza A, Human papillomavirus infection, Human T-cell leukemia virus 1 infection, Kaposi sarcoma-associated herpesvirus infection, Epstein-Barr virus infection, Pathways in cancer, Proteoglycans in cancer, Chemical carcinogenesis - receptor activation, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Endometrial cancer, Glioma, Prostate cancer, Melanoma, Chronic myeloid leukemia, Acute myeloid leukemia, Small cell lung cancer, Non-small cell lung cancer, Breast cancer, Hepatocellular carcinoma, Gastric cancer, Central carbon metabolism in cancer, Choline metabolism in cancer, PD-L1 expression and PD-1 checkpoint pathway in cancer, Lipid and atherosclerosis, Fluid shear stress and atherosclerosis
    Gene Ensembl ENSECAG00000008005, ENSMUSG00000004056, ENSG00000105221, ENSCAFG00845003888, ENSBTAG00000001400, ENSMMUG00000003621
    Target Classification Kinase, Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.