Human FTH1/FHC/FTH ORF/cDNA clone-Lentivirus plasmid (NM_002032)

Cat. No.: pGMLV000308
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FTH1/FHC/FTH Lentiviral expression plasmid for FTH1 lentivirus packaging, FTH1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to Ferritin heavy chain/FTH1/FTH1/FHC products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $438
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000308
Gene Name FTH1
Accession Number NM_002032
Gene ID 2495
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 552 bp
Gene Alias FHC,FTH,FTHL6,HFE5,PIG15,PLIF
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACGACCGCGTCCACCTCGCAGGTGCGCCAGAACTACCACCAGGACTCAGAGGCCGCCATCAACCGCCAGATCAACCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATGTCTTACTACTTTGACCGCGATGATGTGGCTTTGAAGAACTTTGCCAAATACTTTCTTCACCAATCTCATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGAATCTTCCTTCAGGATATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAAAAATGACCCCCATTTGTGTGACTTCATTGAGACACATTACCTGAATGAGCAGGTGAAAGCCATCAAAGAATTGGGTGACCACGTGACCAACTTGCGCAAGATGGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCCTGGGAGACAGTGATAATGAAAGCTAA
ORF Protein Sequence MTTASTSQVRQNYHQDSEAAINRQINLELYASYVYLSMSYYFDRDDVALKNFAKYFLHQSHEEREHAEKLMKLQNQRGGRIFLQDIKKPDCDDWESGLNAMECALHLEKNVNQSLLELHKLATDKNDPHLCDFIETHYLNEQVKAIKELGDHVTNLRKMGAPESGLAEYLFDKHTLGDSDNES

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T89873-Ab Anti-FTH1 monoclonal antibody
    Target Antigen GM-Tg-g-T89873-Ag FTH1 protein
    ORF Viral Vector pGMLV000307 Human FTH1 Lentivirus plasmid
    ORF Viral Vector pGMLV000308 Human FTH1 Lentivirus plasmid
    ORF Viral Vector pGMAP000151 Human FTH1 Adenovirus plasmid
    ORF Viral Vector pGMPC000822 Human FTH1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001052 Human FTH1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000307 Human FTH1 Lentivirus particle
    ORF Viral Vector vGMLV000308 Human FTH1 Lentivirus particle
    ORF Viral Vector vGMAP000151 Human FTH1 Adenovirus particle


    Target information

    Target ID GM-T89873
    Target Name Ferritin heavy chain/FTH1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    2495
    Gene ID 100062811 (Equus caballus), 14319 (Mus musculus), 2495 (Homo sapiens), 25319 (Rattus norvegicus)
    281173 (Bos taurus), 403631 (Canis lupus familiaris), 574118 (Macaca mulatta), 654516 (Felis catus)
    Gene Symbols & Synonyms FTH1,Fth1,FHC,Fth,HFt,MFH,FTH,HFE5,PLIF,FTHL6,NBIA9,PIG15
    Target Alternative Names Cell proliferation-inducing gene 15 protein,FHC,FTH,FTH1,FTHL6,Ferritin H subunit,Ferritin heavy chain,Fth,Fth1,HFE5,HFt,MFH,NBIA9,PIG15,PLIF
    Uniprot Accession O46414,P02794,P09528,P19132,Q2MHN2,Q8MIP0,Q95MP7
    Additional SwissProt Accessions: Q8MIP0,P09528,P02794,P19132,O46414,Q95MP7,Q2MHN2
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG Ferroptosis, Mineral absorption
    Gene Ensembl ENSECAG00000008683, ENSMUSG00000024661, ENSG00000167996, ENSBTAG00000011184, ENSCAFG00845010380, ENSMMUG00000015146
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.