Human MANF/ARMET/ARP ORF/cDNA clone-Lentivirus plasmid (NM_006010.5)

Cat. No.: pGMLV000199
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MANF/ARMET/ARP Lentiviral expression plasmid for MANF lentivirus packaging, MANF lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to ARMET/MANF/MANF/ARMET products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $439.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000199
Gene Name MANF
Accession Number NM_006010.5
Gene ID 7873
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 558 bp
Gene Alias ARMET,ARP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGGAGGATGAGGAGGATGTGGGCCACGCAGGGGCTGGCGGTGGCGCTGGCTCTGAGCGTGCTGCCGGGCAGCCGGGCGCTGCGGCCGGGCGACTGCGAAGTTTGTATTTCTTATCTGGGAAGATTTTACCAGGACCTCAAAGACAGAGATGTCACATTCTCACCAGCCACTATTGAAAACGAACTTATAAAGTTCTGCCGGGAAGCAAGAGGCAAAGAGAATCGGTTGTGCTACTATATCGGGGCCACAGATGATGCAGCCACCAAAATCATCAATGAGGTATCAAAGCCTCTGGCCCACCACATCCCTGTGGAGAAGATCTGTGAGAAGCTTAAGAAGAAGGACAGCCAGATATGTGAGCTTAAGTATGACAAGCAGATCGACCTGAGCACAGTGGACCTGAAGAAGCTCCGAGTTAAAGAGCTGAAGAAGATTCTGGATGACTGGGGGGAGACATGCAAAGGCTGTGCAGAAAAGTCTGACTACATCCGGAAGATAAATGAACTGATGCCTAAATATGCCCCCAAGGCAGCCAGTGCACGGACCGATTTGTAG
ORF Protein Sequence MRRMRRMWATQGLAVALALSVLPGSRALRPGDCEVCISYLGRFYQDLKDRDVTFSPATIENELIKFCREARGKENRLCYYIGATDDAATKIINEVSKPLAHHIPVEKICEKLKKKDSQICELKYDKQIDLSTVDLKKLRVKELKKILDDWGETCKGCAEKSDYIRKINELMPKYAPKAASARTDL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T62415-Ab Anti-MANF/ ARMET/ ARP functional antibody
    Target Antigen GM-Tg-g-T62415-Ag ARMET/MANF protein
    ORF Viral Vector pGMLP003144 Human MANF Lentivirus plasmid
    ORF Viral Vector pGMLV000199 Human MANF Lentivirus plasmid
    ORF Viral Vector pGMLV000783 Human MANF Lentivirus plasmid
    ORF Viral Vector vGMLP003144 Human MANF Lentivirus particle
    ORF Viral Vector vGMLV000199 Human MANF Lentivirus particle
    ORF Viral Vector vGMLV000783 Human MANF Lentivirus particle


    Target information

    Target ID GM-T62415
    Target Name ARMET/MANF
    Gene Group Identifier
    （Target Gene ID in Homo species)         		7873
    Gene ID 100052301 (Equus caballus), 100855747 (Canis lupus familiaris), 101090926 (Felis catus), 315989 (Rattus norvegicus)
    540432 (Bos taurus), 700659 (Macaca mulatta), 74840 (Mus musculus), 7873 (Homo sapiens)
    Gene Symbols & Synonyms MANF,Manf,ARMET,Armet,D18Mgi17,3230402M22Rik,ARP,DDDS
    Target Alternative Names ARMET, MANF,Mesencephalic astrocyte-derived neurotrophic factor,Arginine-rich protein, Protein ARMET,ARP,DDDS,ARMET
    Uniprot Accession P0C5H9,P55145,P80513,Q9CXI5
    Additional SwissProt Accessions: P0C5H9,P80513,Q9CXI5,P55145
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000011938, ENSCAFG00845019756, ENSMUSG00000032575, ENSG00000145050
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.