Human MSI2/MSI2H ORF/cDNA clone-Lentivirus plasmid (NM_138962.3)

Cat. No.: pGMLV000033
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MSI2/MSI2H Lentiviral expression plasmid for MSI2 lentivirus packaging, MSI2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to MSI2/MSI2H products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $546.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000033
Gene Name MSI2
Accession Number NM_138962.3
Gene ID 124540
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 987 bp
Gene Alias MSI2H
Fluorescent Reporter mCherry
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGGCAAATGGGAGCCAAGGCACCTCGGGCAGCGCCAACGACTCCCAGCACGACCCCGGTAAAATGTTTATCGGTGGACTGAGCTGGCAGACCTCACCAGATAGCCTTAGAGACTATTTTAGCAAATTTGGAGAAATTAGAGAATGTATGGTCATGAGAGATCCCACTACGAAACGCTCCAGAGGCTTCGGTTTCGTCACGTTCGCAGACCCAGCAAGTGTAGATAAAGTATTAGGTCAGCCCCACCATGAGTTAGATTCCAAGACGATTGACCCCAAAGTTGCATTTCCTCGTCGAGCGCAACCCAAGATGGTCACAAGAACAAAGAAAATATTTGTAGGCGGGTTATCTGCGAACACAGTAGTGGAAGATGTAAAGCAATATTTCGAGCAGTTTGGCAAGGTGGAAGATGCAATGCTGATGTTTGATAAAACTACCAACAGGCACAGAGGGTTTGGCTTTGTCACTTTTGAGAATGAAGATGTTGTGGAGAAAGTCTGTGAGATTCATTTCCATGAAATCAATAATAAAATGGTAGAATGTAAGAAAGCTCAGCCGAAAGAAGTCATGTTCCCACCTGGGACAAGAGGCCGGGCCCGGGGACTGCCTTACACCATGGACGCGTTCATGCTTGGCATGGGGATGCTGGGATATCCCAACTTCGTGGCGACCTATGGCCGTGGCTACCCCGGATTTGCTCCAAGCTATGGCTATCAGTTCCCAGGCTTCCCAGCAGCGGCTTATGGACCAGTGGCAGCAGCGGCGGTGGCGGCAGCAAGAGGATCAGGCTCCAACCCGGCGCGGCCCGGAGGCTTCCCGGGGGCCAACAGCCCAGGACCTGTCGCCGATCTCTACGGCCCTGCCAGCCAGGACTCCGGAGTGGGGAATTACATAAGTGCGGCCAGCCCACAGCCGGGCTCGGGCTTCGGCCACGGCATAGCTGGACCTTTGATTGCAACGGCCTTTACAAATGGATACCATTGA
ORF Protein Sequence MEANGSQGTSGSANDSQHDPGKMFIGGLSWQTSPDSLRDYFSKFGEIRECMVMRDPTTKRSRGFGFVTFADPASVDKVLGQPHHELDSKTIDPKVAFPRRAQPKMVTRTKKIFVGGLSANTVVEDVKQYFEQFGKVEDAMLMFDKTTNRHRGFGFVTFENEDVVEKVCEIHFHEINNKMVECKKAQPKEVMFPPGTRGRARGLPYTMDAFMLGMGMLGYPNFVATYGRGYPGFAPSYGYQFPGFPAAAYGPVAAAAVAAARGSGSNPARPGGFPGANSPGPVADLYGPASQDSGVGNYISAASPQPGSGFGHGIAGPLIATAFTNGYH

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T35817-Ab Anti-MSI2 monoclonal antibody
    Target Antigen GM-Tg-g-T35817-Ag MSI2 protein
    ORF Viral Vector pGMLV000033 Human MSI2 Lentivirus plasmid
    ORF Viral Vector pGMAP000181 Human MSI2 Adenovirus plasmid
    ORF Viral Vector vGMLV000033 Human MSI2 Lentivirus particle
    ORF Viral Vector vGMAP000181 Human MSI2 Adenovirus particle


    Target information

    Target ID GM-T35817
    Target Name MSI2
    Gene Group Identifier
    （Target Gene ID in Homo species)         		124540
    Gene ID 100070744 (Equus caballus), 100423536 (Macaca mulatta), 101084147 (Felis catus), 124540 (Homo sapiens)
    360596 (Rattus norvegicus), 475148 (Canis lupus familiaris), 505542 (Bos taurus), 76626 (Mus musculus)
    Gene Symbols & Synonyms MSI2,Msi2,MSI2H,RGD1560397,Msi2h,1700105C15Rik
    Target Alternative Names 1700105C15Rik,MSI2,MSI2H,Msi2,Msi2h,Musashi-2,RGD1560397,RNA-binding protein Musashi homolog 2
    Uniprot Accession Q920Q6,Q96DH6
    Additional SwissProt Accessions: Q96DH6,Q920Q6
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG
    Gene Ensembl ENSECAG00000011435, ENSMMUG00000002069, ENSG00000153944, ENSCAFG00845016230, ENSBTAG00000004406, ENSMUSG00000069769
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.