Human E2F1/E2F-1/RBAP1 ORF/cDNA clone-Lentivirus plasmid (NM_005225.2)

Cat. No.: pGMLP005626
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human E2F1/E2F-1/RBAP1 Lentiviral expression plasmid for E2F1 lentivirus packaging, E2F1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to E2F1/E2F-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $667.92
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005626
Gene Name E2F1
Accession Number NM_005225.2
Gene ID 1869
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1314 bp
Gene Alias E2F-1,RBAP1,RBBP3,RBP3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCTTGGCCGGGGCCCCTGCGGGCGGCCCATGCGCGCCGGCGCTGGAGGCCCTGCTCGGGGCCGGCGCGCTGCGGCTGCTCGACTCCTCGCAGATCGTCATCATCTCCGCCGCGCAGGACGCCAGCGCCCCGCCGGCTCCCACCGGCCCCGCGGCGCCCGCCGCCGGCCCCTGCGACCCTGACCTGCTGCTCTTCGCCACACCGCAGGCGCCCCGGCCCACACCCAGTGCGCCGCGGCCCGCGCTCGGCCGCCCGCCGGTGAAGCGGAGGCTGGACCTGGAAACTGACCATCAGTACCTGGCCGAGAGCAGTGGGCCAGCTCGGGGCAGAGGCCGCCATCCAGGAAAAGGTGTGAAATCCCCGGGGGAGAAGTCACGCTATGAGACCTCACTGAATCTGACCACCAAGCGCTTCCTGGAGCTGCTGAGCCACTCGGCTGACGGTGTCGTCGACCTGAACTGGGCTGCCGAGGTGCTGAAGGTGCAGAAGCGGCGCATCTATGACATCACCAACGTCCTTGAGGGCATCCAGCTCATTGCCAAGAAGTCCAAGAACCACATCCAGTGGCTGGGCAGCCACACCACAGTGGGCGTCGGCGGACGGCTTGAGGGGTTGACCCAGGACCTCCGACAGCTGCAGGAGAGCGAGCAGCAGCTGGACCACCTGATGAATATCTGTACTACGCAGCTGCGCCTGCTCTCCGAGGACACTGACAGCCAGCGCCTGGCCTACGTGACGTGTCAGGACCTTCGTAGCATTGCAGACCCTGCAGAGCAGATGGTTATGGTGATCAAAGCCCCTCCTGAGACCCAGCTCCAAGCCGTGGACTCTTCGGAGAACTTTCAGATCTCCCTTAAGAGCAAACAAGGCCCGATCGATGTTTTCCTGTGCCCTGAGGAGACCGTAGGTGGGATCAGCCCTGGGAAGACCCCATCCCAGGAGGTCACTTCTGAGGAGGAGAACAGGGCCACTGACTCTGCCACCATAGTGTCACCACCACCATCATCTCCCCCCTCATCCCTCACCACAGATCCCAGCCAGTCTCTACTCAGCCTGGAGCAAGAACCGCTGTTGTCCCGGATGGGCAGCCTGCGGGCTCCCGTGGACGAGGACCGCCTGTCCCCGCTGGTGGCGGCCGACTCGCTCCTGGAGCATGTGCGGGAGGACTTCTCCGGCCTCCTCCCTGAGGAGTTCATCAGCCTTTCCCCACCCCACGAGGCCCTCGACTACCACTTCGGCCTCGAGGAGGGCGAGGGCATCAGAGACCTCTTCGACTGTGACTTTGGGGACCTCACCCCCCTGGATTTCTGA
ORF Protein Sequence MALAGAPAGGPCAPALEALLGAGALRLLDSSQIVIISAAQDASAPPAPTGPAAPAAGPCDPDLLLFATPQAPRPTPSAPRPALGRPPVKRRLDLETDHQYLAESSGPARGRGRHPGKGVKSPGEKSRYETSLNLTTKRFLELLSHSADGVVDLNWAAEVLKVQKRRIYDITNVLEGIQLIAKKSKNHIQWLGSHTTVGVGGRLEGLTQDLRQLQESEQQLDHLMNICTTQLRLLSEDTDSQRLAYVTCQDLRSIADPAEQMVMVIKAPPETQLQAVDSSENFQISLKSKQGPIDVFLCPEETVGGISPGKTPSQEVTSEEENRATDSATIVSPPPSSPPSSLTTDPSQSLLSLEQEPLLSRMGSLRAPVDEDRLSPLVAADSLLEHVREDFSGLLPEEFISLSPPHEALDYHFGLEEGEGIRDLFDCDFGDLTPLDF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T57059-Ab Anti-E2F1 monoclonal antibody
    Target Antigen GM-Tg-g-T57059-Ag E2F1 protein
    ORF Viral Vector pGMLP005626 Human E2F1 Lentivirus plasmid
    ORF Viral Vector pGMLV000914 Human E2F1 Lentivirus plasmid
    ORF Viral Vector pGMAD000181 Human E2F1 Adenovirus plasmid
    ORF Viral Vector pGMPC000581 Human E2F1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001342 Human E2F1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005626 Human E2F1 Lentivirus particle
    ORF Viral Vector vGMLV000914 Human E2F1 Lentivirus particle
    ORF Viral Vector vGMAD000181 Human E2F1 Adenovirus particle


    Target information

    Target ID GM-T57059
    Target Name E2F1
    Gene Group Identifier
    （Target Gene ID in Homo species)         		1869
    Gene ID 100069192 (Equus caballus), 101098454 (Felis catus), 13555 (Mus musculus), 1869 (Homo sapiens)
    399489 (Rattus norvegicus), 485839 (Canis lupus familiaris), 535369 (Bos taurus), 714126 (Macaca mulatta)
    Gene Symbols & Synonyms E2F1,E2f1,E2F-1,mKIAA4009,Tg(Wnt1-cre)2Sor,RBP3,RBAP1,RBBP3
    Target Alternative Names E2F-1,E2F1,E2f1,PBR3,RBAP1,RBBP3,RBP3,Retinoblastoma-associated protein 1 (RBAP-1),Retinoblastoma-binding protein 3 (RBBP-3),Tg(Wnt1-cre)2Sor,Transcription factor E2F1,mKIAA4009,pRB-binding protein E2F-1
    Uniprot Accession O09139,Q01094,Q61501
    Additional SwissProt Accessions: Q61501,Q01094,O09139
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG Endocrine resistance, Cellular senescence, Cushing syndrome, Hepatitis C, Hepatitis B, Human cytomegalovirus infection, Human papillomavirus infection, Human T-cell leukemia virus 1 infection, Kaposi sarcoma-associated herpesvirus infection, Epstein-Barr virus infection, Pathways in cancer, Chemical carcinogenesis - receptor activation, Pancreatic cancer, Glioma, Prostate cancer, Melanoma, Bladder cancer, Chronic myeloid leukemia, Small cell lung cancer, Non-small cell lung cancer, Breast cancer, Hepatocellular carcinoma, Gastric cancer
    Gene Ensembl ENSECAG00000012086, ENSMUSG00000027490, ENSG00000101412, ENSCAFG00845025182, ENSBTAG00000003971, ENSMMUG00000023550
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.