Human WNT7A ORF/cDNA clone-Lentivirus plasmid (NM_004625.3)

Cat. No.: pGMLP005571
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human WNT7A/ Lentiviral expression plasmid for WNT7A lentivirus packaging, WNT7A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to WNT7A/B/WNT7A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $594
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005571
Gene Name WNT7A
Accession Number NM_004625.3
Gene ID 7476
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1050 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAACCGGAAAGCGCGGCGCTGCCTGGGCCACCTCTTTCTCAGCCTGGGCATGGTCTACCTCCGGATCGGTGGCTTCTCCTCAGTGGTAGCTCTGGGCGCAAGCATCATCTGTAACAAGATCCCAGGCCTGGCTCCCAGACAGCGGGCGATCTGCCAGAGCCGGCCCGACGCCATCATCGTCATAGGAGAAGGCTCACAAATGGGCCTGGACGAGTGTCAGTTTCAGTTCCGCAATGGCCGCTGGAACTGCTCTGCACTGGGAGAGCGCACCGTCTTCGGGAAGGAGCTCAAAGTGGGGAGCCGGGAGGCTGCGTTCACCTACGCCATCATTGCCGCCGGCGTGGCCCACGCCATCACAGCTGCCTGTACCCAGGGCAACCTGAGCGACTGTGGCTGCGACAAAGAGAAGCAAGGCCAGTACCACCGGGACGAGGGCTGGAAGTGGGGTGGCTGCTCTGCCGACATCCGCTACGGCATCGGCTTCGCCAAGGTCTTTGTGGATGCCCGGGAGATCAAGCAGAATGCCCGGACTCTCATGAACTTGCACAACAACGAGGCAGGCCGAAAGATCCTGGAGGAGAACATGAAGCTGGAATGTAAGTGCCACGGCGTGTCAGGCTCGTGCACCACCAAGACGTGCTGGACCACACTGCCACAGTTTCGGGAGCTGGGCTACGTGCTCAAGGACAAGTACAACGAGGCCGTTCACGTGGAGCCTGTGCGTGCCAGCCGCAACAAGCGGCCCACCTTCCTGAAGATCAAGAAGCCACTGTCGTACCGCAAGCCCATGGACACGGACCTGGTGTACATCGAGAAGTCGCCCAACTACTGCGAGGAGGACCCGGTGACCGGCAGTGTGGGCACCCAGGGCCGCGCCTGCAACAAGACGGCTCCCCAGGCCAGCGGCTGTGACCTCATGTGCTGTGGGCGTGGCTACAACACCCACCAGTACGCCCGCGTGTGGCAGTGCAACTGTAAGTTCCACTGGTGCTGCTATGTCAAGTGCAACACGTGCAGCGAGCGCACGGAGATGTACACGTGCAAGTGA
ORF Protein Sequence MNRKARRCLGHLFLSLGMVYLRIGGFSSVVALGASIICNKIPGLAPRQRAICQSRPDAIIVIGEGSQMGLDECQFQFRNGRWNCSALGERTVFGKELKVGSREAAFTYAIIAAGVAHAITAACTQGNLSDCGCDKEKQGQYHRDEGWKWGGCSADIRYGIGFAKVFVDAREIKQNARTLMNLHNNEAGRKILEENMKLECKCHGVSGSCTTKTCWTTLPQFRELGYVLKDKYNEAVHVEPVRASRNKRPTFLKIKKPLSYRKPMDTDLVYIEKSPNYCEEDPVTGSVGTQGRACNKTAPQASGCDLMCCGRGYNTHQYARVWQCNCKFHWCCYVKCNTCSERTEMYTCK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T73908-Ab Anti-WNT7A monoclonal antibody
    Target Antigen GM-Tg-g-T73908-Ag WNT7A VLP (virus-like particle)
    Cytokine cks-Tg-g-GM-T73908 wingless-type MMTV integration site family, member 7A (WNT7A) protein & antibody
    ORF Viral Vector pGMLP000595 Human WNT7A Lentivirus plasmid
    ORF Viral Vector pGMLP005571 Human WNT7A Lentivirus plasmid
    ORF Viral Vector pGMAP000321 Human WNT7A Adenovirus plasmid
    ORF Viral Vector vGMLP000595 Human WNT7A Lentivirus particle
    ORF Viral Vector vGMLP005571 Human WNT7A Lentivirus particle
    ORF Viral Vector vGMAP000321 Human WNT7A Adenovirus particle


    Target information

    Target ID GM-T73908
    Target Name WNT7A/B
    Gene Group Identifier
    （Target Gene ID in Homo species)         		7476
    Gene ID 101083664 (Felis catus), 114850 (Rattus norvegicus), 22421 (Mus musculus), 533782 (Bos taurus)
    607180 (Canis lupus familiaris), 693419 (Macaca mulatta), 7476 (Homo sapiens)
    Gene Symbols & Synonyms WNT7A,Wnt7a,px,tw,Wnt-7a,SANTOS
    Target Alternative Names WNT7A, B,Protein Wnt-7a,SANTOS,Wnt-7a
    Uniprot Accession O00755,P24383
    Additional SwissProt Accessions: P24383,O00755
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Cytokine Target
    Disease cancer
    Disease from KEGG Wnt signaling pathway, Hippo signaling pathway, Signaling pathways regulating pluripotency of stem cells, Melanogenesis, Cushing syndrome, Alzheimer disease, Human papillomavirus infection, Pathways in cancer, Proteoglycans in cancer, Basal cell carcinoma, Breast cancer, Hepatocellular carcinoma, Gastric cancer
    Gene Ensembl ENSMUSG00000030093, ENSCAFG00845023657, ENSMMUG00000018445, ENSG00000154764
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.