Human PDCD1/CD279/hPD-1 ORF/cDNA clone-Lentivirus plasmid (NM_005018.2)
Cat. No.: pGMLP005557
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human PDCD1/CD279/hPD-1 Lentiviral expression plasmid for PDCD1 lentivirus packaging, PDCD1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
PD-1/CD279/PDCD1/PDCD1/CD279 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLP005557 |
| Gene Name | PDCD1 |
| Accession Number | NM_005018.2 |
| Gene ID | 5133 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 867 bp |
| Gene Alias | CD279,hPD-1,hPD-l,hSLE1,PD-1,PD1,SLEB2 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCAGATCCCACAGGCGCCCTGGCCAGTCGTCTGGGCGGTGCTACAACTGGGCTGGCGGCCAGGATGGTTCTTAGACTCCCCAGACAGGCCCTGGAACCCCCCCACCTTCTCCCCAGCCCTGCTCGTGGTGACCGAAGGGGACAACGCCACCTTCACCTGCAGCTTCTCCAACACATCGGAGAGCTTCGTGCTAAACTGGTACCGCATGAGCCCCAGCAACCAGACGGACAAGCTGGCCGCCTTCCCCGAGGACCGCAGCCAGCCCGGCCAGGACTGCCGCTTCCGTGTCACACAACTGCCCAACGGGCGTGACTTCCACATGAGCGTGGTCAGGGCCCGGCGCAATGACAGCGGCACCTACCTCTGTGGGGCCATCTCCCTGGCCCCCAAGGCGCAGATCAAAGAGAGCCTGCGGGCAGAGCTCAGGGTGACAGAGAGAAGGGCAGAAGTGCCCACAGCCCACCCCAGCCCCTCACCCAGGCCAGCCGGCCAGTTCCAAACCCTGGTGGTTGGTGTCGTGGGCGGCCTGCTGGGCAGCCTGGTGCTGCTAGTCTGGGTCCTGGCCGTCATCTGCTCCCGGGCCGCACGAGGGACAATAGGAGCCAGGCGCACCGGCCAGCCCCTGAAGGAGGACCCCTCAGCCGTGCCTGTGTTCTCTGTGGACTATGGGGAGCTGGATTTCCAGTGGCGAGAGAAGACCCCGGAGCCCCCCGTGCCCTGTGTCCCTGAGCAGACGGAGTATGCCACCATTGTCTTTCCTAGCGGAATGGGCACCTCATCCCCCGCCCGCAGGGGCTCAGCTGACGGCCCTCGGAGTGCCCAGCCACTGAGGCCTGAGGATGGACACTGCTCTTGGCCCCTCTGA |
| ORF Protein Sequence | MQIPQAPWPVVWAVLQLGWRPGWFLDSPDRPWNPPTFSPALLVVTEGDNATFTCSFSNTSESFVLNWYRMSPSNQTDKLAAFPEDRSQPGQDCRFRVTQLPNGRDFHMSVVRARRNDSGTYLCGAISLAPKAQIKESLRAELRVTERRAEVPTAHPSPSPRPAGQFQTLVVGVVGGLLGSLVLLVWVLAVICSRAARGTIGARRTGQPLKEDPSAVPVFSVDYGELDFQWREKTPEPPVPCVPEQTEYATIVFPSGMGTSSPARRGSADGPRSAQPLRPEDGHCSWPL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
| Target ID | GM-T59631 |
| Target Name | PD-1/CD279/PDCD1 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
5133 |
| Gene ID |
100067948 (Equus caballus), 100135770 (Felis catus), 100135775 (Macaca mulatta), 18566 (Mus musculus) 301626 (Rattus norvegicus), 486213 (Canis lupus familiaris), 5133 (Homo sapiens), 613842 (Bos taurus) |
| Gene Symbols & Synonyms | PDCD1,Pdcd1,PD-1,PD1,Pdc1,Ly101,CD279,SLEB2,hPD-1,hPD-l,hSLE1,AIMTBS |
| Target Alternative Names | AIMTBS,CD279,Ly101,PD-1,PD1,PDCD1,Pdc1,Pdcd1,Programmed cell death protein 1,Protein PD-1,SLEB2,hPD-1,hPD-l,hSLE1 |
| Uniprot Accession |
Q02242,Q15116
Additional SwissProt Accessions: Q02242,Q15116 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, Immuno-oncology Target, INN Index |
| Disease | cancer |
| Disease from KEGG | Cell adhesion molecules, T cell receptor signaling pathway, PD-L1 expression and PD-1 checkpoint pathway in cancer |
| Gene Ensembl | ENSECAG00000023275, ENSMMUG00000063159, ENSMUSG00000026285, ENSCAFG00845024308, ENSG00000188389, ENSBTAG00000011543 |
| Target Classification | Checkpoint-Immuno Oncology, Cytokine Receptor, Pathway, Tumor-associated antigen (TAA) |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


