Human MAPK3/ERK-1/ERK1 ORF/cDNA clone-Lentivirus plasmid (NM_002746.2)

Cat. No.: pGMLP005482
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MAPK3/ERK-1/ERK1 Lentiviral expression plasmid for MAPK3 lentivirus packaging, MAPK3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to MAPK3/ERK1/MAPK3/ERK-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $619.2
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005482
Gene Name MAPK3
Accession Number NM_002746.2
Gene ID 5595
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1140 bp
Gene Alias ERK-1,ERK1,ERT2,HS44KDAP,HUMKER1A,p44-ERK1,p44-MAPK,P44ERK1,P44MAPK,PRKM3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGCGGCGGCGGCTCAGGGGGGCGGGGGCGGGGAGCCCCGTAGAACCGAGGGGGTCGGCCCGGGGGTCCCGGGGGAGGTGGAGATGGTGAAGGGGCAGCCGTTCGACGTGGGCCCGCGCTACACGCAGTTGCAGTACATCGGCGAGGGCGCGTACGGCATGGTCAGCTCGGCCTATGACCACGTGCGCAAGACTCGCGTGGCCATCAAGAAGATCAGCCCCTTCGAACATCAGACCTACTGCCAGCGCACGCTCCGGGAGATCCAGATCCTGCTGCGCTTCCGCCATGAGAATGTCATCGGCATCCGAGACATTCTGCGGGCGTCCACCCTGGAAGCCATGAGAGATGTCTACATTGTGCAGGACCTGATGGAGACTGACCTGTACAAGTTGCTGAAAAGCCAGCAGCTGAGCAATGACCATATCTGCTACTTCCTCTACCAGATCCTGCGGGGCCTCAAGTACATCCACTCCGCCAACGTGCTCCACCGAGATCTAAAGCCCTCCAACCTGCTCATCAACACCACCTGCGACCTTAAGATTTGTGATTTCGGCCTGGCCCGGATTGCCGATCCTGAGCATGACCACACCGGCTTCCTGACGGAGTATGTGGCTACGCGCTGGTACCGGGCCCCAGAGATCATGCTGAACTCCAAGGGCTATACCAAGTCCATCGACATCTGGTCTGTGGGCTGCATTCTGGCTGAGATGCTCTCTAACCGGCCCATCTTCCCTGGCAAGCACTACCTGGATCAGCTCAACCACATTCTGGGCATCCTGGGCTCCCCATCCCAGGAGGACCTGAATTGTATCATCAACATGAAGGCCCGAAACTACCTACAGTCTCTGCCCTCCAAGACCAAGGTGGCTTGGGCCAAGCTTTTCCCCAAGTCAGACTCCAAAGCCCTTGACCTGCTGGACCGGATGTTAACCTTTAACCCCAATAAACGGATCACAGTGGAGGAAGCGCTGGCTCACCCCTACCTGGAGCAGTACTATGACCCGACGGATGAGCCAGTGGCCGAGGAGCCCTTCACCTTCGCCATGGAGCTGGATGACCTACCTAAGGAGCGGCTGAAGGAGCTCATCTTCCAGGAGACAGCACGCTTCCAGCCCGGAGTGCTGGAGGCCCCCTAG
ORF Protein Sequence MAAAAAQGGGGGEPRRTEGVGPGVPGEVEMVKGQPFDVGPRYTQLQYIGEGAYGMVSSAYDHVRKTRVAIKKISPFEHQTYCQRTLREIQILLRFRHENVIGIRDILRASTLEAMRDVYIVQDLMETDLYKLLKSQQLSNDHICYFLYQILRGLKYIHSANVLHRDLKPSNLLINTTCDLKICDFGLARIADPEHDHTGFLTEYVATRWYRAPEIMLNSKGYTKSIDIWSVGCILAEMLSNRPIFPGKHYLDQLNHILGILGSPSQEDLNCIINMKARNYLQSLPSKTKVAWAKLFPKSDSKALDLLDRMLTFNPNKRITVEEALAHPYLEQYYDPTDEPVAEEPFTFAMELDDLPKERLKELIFQETARFQPGVLEAP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T23276-Ab Anti-ERK1 monoclonal antibody
    Target Antigen GM-Tg-g-T23276-Ag ERK1/MAPK3 protein
    ORF Viral Vector pGMLP005482 Human MAPK3 Lentivirus plasmid
    ORF Viral Vector pGMLP005593 Human MAPK3 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-054 Human MAPK3 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-194 Human MAPK3 Adenovirus plasmid
    ORF Viral Vector vGMLP005482 Human MAPK3 Lentivirus particle
    ORF Viral Vector vGMLP005593 Human MAPK3 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-054 Human MAPK3 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-194 Human MAPK3 Adenovirus particle


    Target information

    Target ID GM-T23276
    Target Name MAPK3/ERK1
    Gene Group Identifier
    （Target Gene ID in Homo species)         		5595
    Gene ID 100066173 (Equus caballus), 100855877 (Canis lupus familiaris), 101087958 (Felis catus), 26417 (Mus musculus)
    50689 (Rattus norvegicus), 531391 (Bos taurus), 5595 (Homo sapiens), 708938 (Macaca mulatta)
    Gene Symbols & Synonyms MAPK3,Mapk3,p44,Erk1,Ert2,Mnk1,Erk-1,Esrk1,Prkm3,Mtap2k,p44erk1,p44mapk,ERK1,ERT2,MNK1,MAPK1,ERK-1,PRKM3,P44ERK1,P44MAPK,HS44KDAP,HUMKER1A,p44-ERK1,p44-MAPK
    Target Alternative Names ERK-1,ERK1,ERT2,Erk-1,Erk1,Ert2,Esrk1,Extracellular signal-regulated kinase 1 (ERK-1),HS44KDAP,HUMKER1A,Insulin-stimulated MAP2 kinase,MAP kinase 3,MAP kinase isoform p44 (p44-MAPK),MAPK 3,MAPK1,MAPK3,MNK1,Mapk3,Microtubule-associated protein 2 kinase,Mitogen-activated protein kinase 3,Mnk1,Mtap2k,P44ERK1,P44MAPK,PRKM3,Prkm3,p44,p44-ERK1,p44-MAPK,p44erk1,p44mapk
    Uniprot Accession P21708,P27361,Q63844
    Additional SwissProt Accessions: Q63844,P21708,P27361
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer, IgA glomerulonephritis
    Disease from KEGG EGFR tyrosine kinase inhibitor resistance, Endocrine resistance, MAPK signaling pathway, ErbB signaling pathway, Ras signaling pathway, Rap1 signaling pathway, cGMP-PKG signaling pathway, cAMP signaling pathway, Chemokine signaling pathway, HIF-1 signaling pathway, FoxO signaling pathway, Sphingolipid signaling pathway, Phospholipase D signaling pathway, PI3K-Akt signaling pathway, Apoptosis, Cellular senescence, Adrenergic signaling in cardiomyocytes, Vascular smooth muscle contraction, TGF-beta signaling pathway, Axon guidance, Osteoclast differentiation, Focal adhesion, Adherens junction, Gap junction, Signaling pathways regulating pluripotency of stem cells, Platelet activation, Toll-like receptor signaling pathway, NOD-like receptor signaling pathway, C-type lectin receptor signaling pathway, Natural killer cell mediated cytotoxicity, IL-17 signaling pathway, Th1 and Th2 cell differentiation, Th17 cell differentiation, T cell receptor signaling pathway, B cell receptor signaling pathway, Fc epsilon RI signaling pathway, TNF signaling pathway, Circadian entrainment, Long-term potentiation, Neurotrophin signaling pathway, Glutamatergic synapse, Cholinergic synapse, Serotonergic synapse, Regulation of actin cytoskeleton, GnRH signaling pathway, Melanogenesis, Prolactin signaling pathway, Thyroid hormone signaling pathway, Oxytocin signaling pathway, Relaxin signaling pathway, Parathyroid hormone synthesis, secretion and action, GnRH secretion, Type II diabetes mellitus, AGE-RAGE signaling pathway in diabetic complications, Cushing syndrome, Growth hormone synthesis, secretion and action, Aldosterone-regulated sodium reabsorption, Alzheimer disease, Pathogenic Escherichia coli infection, Pertussis, Yersinia infection, Leishmaniasis, Chagas disease, Toxoplasmosis, Tuberculosis, Hepatitis C, Hepatitis B, Human cytomegalovirus infection, Influenza A, Human papillomavirus infection, Human T-cell leukemia virus 1 infection, Kaposi sarcoma-associated herpesvirus infection, Pathways in cancer, Proteoglycans in cancer, Chemical carcinogenesis - receptor activation, Colorectal cancer, Renal cell carcinoma, Pancreatic cancer, Endometrial cancer, Glioma, Prostate cancer, Thyroid cancer, Melanoma, Bladder cancer, Chronic myeloid leukemia, Acute myeloid leukemia, Non-small cell lung cancer, Breast cancer, Hepatocellular carcinoma, Gastric cancer, Central carbon metabolism in cancer, Choline metabolism in cancer, PD-L1 expression and PD-1 checkpoint pathway in cancer, Lipid and atherosclerosis
    Gene Ensembl ENSECAG00000014460, ENSCAFG00845002016, ENSMUSG00000063065, ENSBTAG00000016156, ENSG00000102882, ENSMMUG00000017758
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.