Human TK1/TK2 ORF/cDNA clone-Lentivirus plasmid (NM_003258.4)

Cat. No.: pGMLP005411
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TK1/TK2 Lentiviral expression plasmid for TK1 lentivirus packaging, TK1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to TK1/TK2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $476.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005411
Gene Name TK1
Accession Number NM_003258.4
Gene ID 7083
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 705 bp
Gene Alias TK2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCTGCATTAACCTGCCCACTGTGCTGCCTGGCTCCCCCAGCAAGACCCGGGGGCAGATCCAGGTGATTCTCGGGCCGATGTTCTCAGGAAAAAGCACAGAGTTGATGAGACGCGTCCGTCGCTTCCAGATTGCTCAGTACAAGTGCCTGGTGATCAAGTATGCCAAAGACACTCGCTACAGCAGCAGCTTCTGCACACATGACCGGAACACCATGGAGGCACTGCCCGCCTGCCTGCTCCGAGACGTGGCCCAGGAGGCCCTGGGCGTGGCTGTCATAGGCATCGACGAGGGGCAGTTTTTCCCTGACATCGTGGAGTTCTGCGAGGCCATGGCCAACGCCGGGAAGACCGTAATTGTGGCTGCACTGGATGGGACCTTCCAGAGGAAGCCATTTGGGGCCATCCTGAACCTGGTGCCGCTGGCCGAGAGCGTGGTGAAGCTGACGGCGGTGTGCATGGAGTGCTTCCGGGAAGCCGCCTATACCAAGAGGCTCGGCACAGAGAAGGAGGTCGAGGTGATTGGGGGAGCAGACAAGTACCACTCCGTGTGTCGGCTCTGCTACTTCAAGAAGGCCTCAGGCCAGCCTGCCGGGCCGGACAACAAAGAGAACTGCCCAGTGCCAGGAAAGCCAGGGGAAGCCGTGGCTGCCAGGAAGCTCTTTGCCCCACAGCAGATTCTGCAATGCAGCCCTGCCAACTGA
ORF Protein Sequence MSCINLPTVLPGSPSKTRGQIQVILGPMFSGKSTELMRRVRRFQIAQYKCLVIKYAKDTRYSSSFCTHDRNTMEALPACLLRDVAQEALGVAVIGIDEGQFFPDIVEFCEAMANAGKTVIVAALDGTFQRKPFGAILNLVPLAESVVKLTAVCMECFREAAYTKRLGTEKEVEVIGGADKYHSVCRLCYFKKASGQPAGPDNKENCPVPGKPGEAVAARKLFAPQQILQCSPAN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T30081-Ab Anti-TK1 monoclonal antibody
    Target Antigen GM-Tg-g-T30081-Ag TK1 protein
    ORF Viral Vector pGMLP005411 Human TK1 Lentivirus plasmid
    ORF Viral Vector vGMLP005411 Human TK1 Lentivirus particle


    Target information

    Target ID GM-T30081
    Target Name TK1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    7083
    Gene ID 100057908 (Equus caballus), 100855947 (Canis lupus familiaris), 101101270 (Felis catus), 21877 (Mus musculus)
    24834 (Rattus norvegicus), 504652 (Bos taurus), 7083 (Homo sapiens), 709403 (Macaca mulatta)
    Gene Symbols & Synonyms TK1,Tk1,Tk-1,Tk1a,Tk1b,D530002A18Rik,Tk,TK2
    Target Alternative Names D530002A18Rik,TK1,TK2,Thymidine kinase,Tk,Tk-1,Tk1,Tk1a,Tk1b,cytosolic
    Uniprot Accession A5D7R8,P04183,P04184,P27158
    Additional SwissProt Accessions: P04184,P27158,A5D7R8,P04183
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Diagnostics Biomarker, Immuno-oncology Target
    Disease
    Disease from KEGG Metabolic pathways
    Gene Ensembl ENSECAG00000016173, ENSCAFG00845014848, ENSMUSG00000025574, ENSBTAG00000007121, ENSG00000167900
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.