Human TK1/TK2 ORF/cDNA clone-Lentivirus plasmid (NM_003258.4)
Cat. No.: pGMLP005411
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human TK1/TK2 Lentiviral expression plasmid for TK1 lentivirus packaging, TK1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
TK1/TK2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLP005411 |
| Gene Name | TK1 |
| Accession Number | NM_003258.4 |
| Gene ID | 7083 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 705 bp |
| Gene Alias | TK2 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAGCTGCATTAACCTGCCCACTGTGCTGCCTGGCTCCCCCAGCAAGACCCGGGGGCAGATCCAGGTGATTCTCGGGCCGATGTTCTCAGGAAAAAGCACAGAGTTGATGAGACGCGTCCGTCGCTTCCAGATTGCTCAGTACAAGTGCCTGGTGATCAAGTATGCCAAAGACACTCGCTACAGCAGCAGCTTCTGCACACATGACCGGAACACCATGGAGGCACTGCCCGCCTGCCTGCTCCGAGACGTGGCCCAGGAGGCCCTGGGCGTGGCTGTCATAGGCATCGACGAGGGGCAGTTTTTCCCTGACATCGTGGAGTTCTGCGAGGCCATGGCCAACGCCGGGAAGACCGTAATTGTGGCTGCACTGGATGGGACCTTCCAGAGGAAGCCATTTGGGGCCATCCTGAACCTGGTGCCGCTGGCCGAGAGCGTGGTGAAGCTGACGGCGGTGTGCATGGAGTGCTTCCGGGAAGCCGCCTATACCAAGAGGCTCGGCACAGAGAAGGAGGTCGAGGTGATTGGGGGAGCAGACAAGTACCACTCCGTGTGTCGGCTCTGCTACTTCAAGAAGGCCTCAGGCCAGCCTGCCGGGCCGGACAACAAAGAGAACTGCCCAGTGCCAGGAAAGCCAGGGGAAGCCGTGGCTGCCAGGAAGCTCTTTGCCCCACAGCAGATTCTGCAATGCAGCCCTGCCAACTGA |
| ORF Protein Sequence | MSCINLPTVLPGSPSKTRGQIQVILGPMFSGKSTELMRRVRRFQIAQYKCLVIKYAKDTRYSSSFCTHDRNTMEALPACLLRDVAQEALGVAVIGIDEGQFFPDIVEFCEAMANAGKTVIVAALDGTFQRKPFGAILNLVPLAESVVKLTAVCMECFREAAYTKRLGTEKEVEVIGGADKYHSVCRLCYFKKASGQPAGPDNKENCPVPGKPGEAVAARKLFAPQQILQCSPAN |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T30081-Ab | Anti-TK1 monoclonal antibody |
| Target Antigen | GM-Tg-g-T30081-Ag | TK1 protein |
| ORF Viral Vector | pGMLP005411 | Human TK1 Lentivirus plasmid |
| ORF Viral Vector | vGMLP005411 | Human TK1 Lentivirus particle |
Target information
| Target ID | GM-T30081 |
| Target Name | TK1 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
7083 |
| Gene ID |
100057908 (Equus caballus), 100855947 (Canis lupus familiaris), 101101270 (Felis catus), 21877 (Mus musculus) 24834 (Rattus norvegicus), 504652 (Bos taurus), 7083 (Homo sapiens), 709403 (Macaca mulatta) |
| Gene Symbols & Synonyms | TK1,Tk1,Tk-1,Tk1a,Tk1b,D530002A18Rik,Tk,TK2 |
| Target Alternative Names | D530002A18Rik,TK1,TK2,Thymidine kinase,Tk,Tk-1,Tk1,Tk1a,Tk1b,cytosolic |
| Uniprot Accession |
A5D7R8,P04183,P04184,P27158
Additional SwissProt Accessions: P04184,P27158,A5D7R8,P04183 |
| Uniprot Entry Name | |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target, Diagnostics Biomarker, Immuno-oncology Target |
| Disease | |
| Disease from KEGG | Metabolic pathways |
| Gene Ensembl | ENSECAG00000016173, ENSCAFG00845014848, ENSMUSG00000025574, ENSBTAG00000007121, ENSG00000167900 |
| Target Classification | Checkpoint-Immuno Oncology |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


