Human PIM1/PIM ORF/cDNA clone-Lentivirus plasmid (NM_002648.3)

Cat. No.: pGMLP005380
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PIM1/PIM Lentiviral expression plasmid for PIM1 lentivirus packaging, PIM1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to PIM1/PIM products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $535.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005380
Gene Name PIM1
Accession Number NM_002648.3
Gene ID 5292
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 942 bp
Gene Alias PIM
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTCTTGTCCAAAATCAACTCGCTTGCCCACCTGCGCGCCGCGCCCTGCAACGACCTGCACGCCACCAAGCTGGCGCCCGGCAAGGAGAAGGAGCCCCTGGAGTCGCAGTACCAGGTGGGCCCGCTACTGGGCAGCGGCGGCTTCGGCTCGGTCTACTCAGGCATCCGCGTCTCCGACAACTTGCCGGTGGCCATCAAACACGTGGAGAAGGACCGGATTTCCGACTGGGGAGAGCTGCCTAATGGCACTCGAGTGCCCATGGAAGTGGTCCTGCTGAAGAAGGTGAGCTCGGGTTTCTCCGGCGTCATTAGGCTCCTGGACTGGTTCGAGAGGCCCGACAGTTTCGTCCTGATCCTGGAGAGGCCCGAGCCGGTGCAAGATCTCTTCGACTTCATCACGGAAAGGGGAGCCCTGCAAGAGGAGCTGGCCCGCAGCTTCTTCTGGCAGGTGCTGGAGGCCGTGCGGCACTGCCACAACTGCGGGGTGCTCCACCGCGACATCAAGGACGAAAACATCCTTATCGACCTCAATCGCGGCGAGCTCAAGCTCATCGACTTCGGGTCGGGGGCGCTGCTCAAGGACACCGTCTACACGGACTTCGATGGGACCCGAGTGTATAGCCCTCCAGAGTGGATCCGCTACCATCGCTACCATGGCAGGTCGGCGGCAGTCTGGTCCCTGGGGATCCTGCTGTATGATATGGTGTGTGGAGATATTCCTTTCGAGCATGACGAAGAGATCATCAGGGGCCAGGTTTTCTTCAGGCAGAGGGTCTCTTCAGAATGTCAGCATCTCATTAGATGGTGCTTGGCCCTGAGACCATCAGATAGGCCAACCTTCGAAGAAATCCAGAACCATCCATGGATGCAAGATGTTCTCCTGCCCCAGGAAACTGCTGAGATCCACCTCCACAGCCTGTCGCCGGGGCCCAGCAAATAG
ORF Protein Sequence MLLSKINSLAHLRAAPCNDLHATKLAPGKEKEPLESQYQVGPLLGSGGFGSVYSGIRVSDNLPVAIKHVEKDRISDWGELPNGTRVPMEVVLLKKVSSGFSGVIRLLDWFERPDSFVLILERPEPVQDLFDFITERGALQEELARSFFWQVLEAVRHCHNCGVLHRDIKDENILIDLNRGELKLIDFGSGALLKDTVYTDFDGTRVYSPPEWIRYHRYHGRSAAVWSLGILLYDMVCGDIPFEHDEEIIRGQVFFRQRVSSECQHLIRWCLALRPSDRPTFEEIQNHPWMQDVLLPQETAEIHLHSLSPGPSK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T50594-Ab Anti-PIM1 monoclonal antibody
    Target Antigen GM-Tg-g-T50594-Ag PIM1 protein
    ORF Viral Vector pGMLP005380 Human PIM1 Lentivirus plasmid
    ORF Viral Vector pGMLV001605 Human PIM1 Lentivirus plasmid
    ORF Viral Vector pGMAD001584 Human PIM1 Adenovirus plasmid
    ORF Viral Vector pGMAP000309 Human PIM1 Adenovirus plasmid
    ORF Viral Vector pGMPC000811 Human PIM1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005380 Human PIM1 Lentivirus particle
    ORF Viral Vector vGMLV001605 Human PIM1 Lentivirus particle
    ORF Viral Vector vGMAD001584 Human PIM1 Adenovirus particle
    ORF Viral Vector vGMAP000309 Human PIM1 Adenovirus particle


    Target information

    Target ID GM-T50594
    Target Name PIM1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    5292
    Gene ID 100053898 (Equus caballus), 114677751 (Macaca mulatta), 18712 (Mus musculus), 24649 (Rattus norvegicus)
    281402 (Bos taurus), 493888 (Felis catus), 5292 (Homo sapiens)
    Gene Symbols & Synonyms PIM1,Pim1,Pim-1,pim-1,PIM
    Target Alternative Names PIM,PIM1,Pim-1,Pim1,Serine/threonine-protein kinase pim-1,pim-1
    Uniprot Accession P06803,P11309,P26794,Q95LJ0,Q9N0P9
    Additional SwissProt Accessions: P06803,P26794,Q9N0P9,Q95LJ0,P11309
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG JAK-STAT signaling pathway, AGE-RAGE signaling pathway in diabetic complications, Pathways in cancer, Acute myeloid leukemia
    Gene Ensembl ENSECAG00000020563, ENSMUSG00000024014, ENSBTAG00000000396, ENSG00000137193
    Target Classification Kinase, Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.