Human AURKB/AIK2/AIM-1 ORF/cDNA clone-Lentivirus plasmid (NM_001313950.1)

Cat. No.: pGMLP005299
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human AURKB/AIK2/AIM-1 Lentiviral expression plasmid for AURKB lentivirus packaging, AURKB lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to AURKB/AIK2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $589.8
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005299
Gene Name AURKB
Accession Number NM_001313950.1
Gene ID 9212
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1035 bp
Gene Alias AIK2,AIM-1,AIM1,ARK-2,ARK2,AurB,aurkb-sv1,aurkb-sv2,IPL1,PPP1R48,STK-1,STK12,STK5
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCCAGAAGGAGAACTCCTACCCCTGGCCCTACGGCCGACAGACGGCTCCATCTGGCCTGAGCACCCTGCCCCAGCGAGTCCTCCGGAAAGAGCCTGTCACCCCATCTGCACTTGTCCTCATGAGCCGCTCCAATGTCCAGCCCACAGCTGCCCCTGGCCAGAAGGTGATGGAGAATAGCAGTGGGACACCCGACATCTTAACGCGGCACTTCACAATTGATGACTTTGAGATTGGGCGTCCTCTGGGCAAAGGCAAGTTTGGAAACGTGTACTTGGCTCGGGAGAAGAAAAGCCATTTCATCGTGGCGCTCAAGGTCCTCTTCAAGTCCCAGATAGAGAAGGAGGGCGTGGAGCATCAGCTGCGCAGAGAGATCGAAATCCAGGCCCACCTGCACCATCCCAACATCCTGCGTCTCTACAACTATTTTTATGACCGGAGGAGGATCTACTTGATTCTAGAGTATGCCCCCCGCGGGGAGCTCTACAAGGAGCTGCAGAAGAGCTGCACATTTGACGAGCAGCGAACAGCCACGATCATGGAGGAGTTGGCAGATGCTCTAATGTACTGCCATGGGAAGAAGGTGATTCACAGAGACATAAAGCCAGAAAATCTGCTCTTAGGGCTCAAGGGAGAGCTGAAGATTGCTGACTTCGGCTGGTCTGTGCATGCGCCCTCCCTGAGGAGGAAGACAATGTGTGGCACCCTGGACTACCTGCCCCCAGAGATGATTGAGGGGCGCATGCACAATGAGAAGGTGGATCTGTGGTGCATTGGAGTGCTTTGCTATGAGCTGCTGGTGGGGAACCCACCCTTTGAGAGTGCATCACACAACGAGACCTATCGCCGCATCGTCAAGGTGGACCTAAAGTTCCCCGCTTCCGTGCCCATGGGAGCCCAGGACCTCATCTCCAAACTGCTCAGGCATAACCCCTCGGAACGGCTGCCCCTGGCCCAGGTCTCAGCCCACCCTTGGGTCCGGGCCAACTCTCGGAGGGTGCTGCCTCCCTCTGCCCTTCAATCTGTCGCCTGA
ORF Protein Sequence MAQKENSYPWPYGRQTAPSGLSTLPQRVLRKEPVTPSALVLMSRSNVQPTAAPGQKVMENSSGTPDILTRHFTIDDFEIGRPLGKGKFGNVYLAREKKSHFIVALKVLFKSQIEKEGVEHQLRREIEIQAHLHHPNILRLYNYFYDRRRIYLILEYAPRGELYKELQKSCTFDEQRTATIMEELADALMYCHGKKVIHRDIKPENLLLGLKGELKIADFGWSVHAPSLRRKTMCGTLDYLPPEMIEGRMHNEKVDLWCIGVLCYELLVGNPPFESASHNETYRRIVKVDLKFPASVPMGAQDLISKLLRHNPSERLPLAQVSAHPWVRANSRRVLPPSALQSVA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T46781-Ab Anti-AURKB monoclonal antibody
    Target Antigen GM-Tg-g-T46781-Ag AURKB protein
    ORF Viral Vector pGMLP005299 Human AURKB Lentivirus plasmid
    ORF Viral Vector pGMPC000527 Human AURKB Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005299 Human AURKB Lentivirus particle


    Target information

    Target ID GM-T46781
    Target Name AURKB
    Gene Group Identifier
    （Target Gene ID in Homo species)         		9212
    Gene ID 100073050 (Equus caballus), 101081264 (Felis catus), 114592 (Rattus norvegicus), 20877 (Mus musculus)
    360192 (Bos taurus), 479492 (Canis lupus familiaris), 721955 (Macaca mulatta), 9212 (Homo sapiens)
    Gene Symbols & Synonyms AURKB,Aurkb,Aim1,ARK-2,STK-1,Stk12,Aik2,Ark2,AurB,IPL1,Stk5,AIM-1,AIRK2,STK12,AIK2,AIM1,ARK2,STK5,PPP1R48,aurkb-sv1,aurkb-sv2
    Target Alternative Names AIK2,AIM-1,AIM1,AIRK2,ARK-2,ARK2,AURKB,Aik2,Aim1,Ark2,AurB,Aurkb,Aurora 1,Aurora kinase B,Aurora- and IPL1-like midbody-associated protein 1 (AIM-1),Aurora-related kinase 2),Aurora/IPL1-related kinase 2 (ARK-2,IPL1,PPP1R48,STK-1,STK12,STK5,Serine/threonine-protein kinase 12,Serine/threonine-protein kinase 5,Serine/threonine-protein kinase aurora-B,Stk12,Stk5,aurkb-sv1,aurkb-sv2
    Uniprot Accession O55099,O70126,Q7YRC6,Q96GD4
    Additional SwissProt Accessions: O55099,O70126,Q7YRC6,Q96GD4
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG
    Gene Ensembl ENSECAG00000014384, ENSMUSG00000020897, ENSBTAG00000001717, ENSCAFG00845028309, ENSMMUG00000002997, ENSG00000178999
    Target Classification Kinase, Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.