Human CIB1/CIB/CIBP ORF/cDNA clone-Lentivirus plasmid (NM_006384.3)

Cat. No.: pGMLP005192
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CIB1/CIB/CIBP Lentiviral expression plasmid for CIB1 lentivirus packaging, CIB1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CIB1/CIB products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $444
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005192
Gene Name CIB1
Accession Number NM_006384.3
Gene ID 10519
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 576 bp
Gene Alias CIB,CIBP,KIP1,PRKDCIP,SIP2-28
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGGGCTCGGGCAGTCGCCTGTCCAAGGAGCTGCTGGCCGAGTACCAGGACTTGACGTTCCTGACGAAGCAGGAGATCCTCCTAGCCCACAGGCGGTTTTGTGAGCTGCTTCCCCAGGAGCAGCGGAGCGTGGAGTCGTCACTTCGGGCACAAGTGCCCTTCGAGCAGATTCTCAGCCTTCCAGAGCTCAAGGCCAACCCCTTCAAGGAGCGAATCTGCAGGGTCTTCTCCACATCCCCAGCCAAAGACAGCCTTAGCTTTGAGGACTTCCTGGATCTCCTCAGTGTGTTCAGTGACACAGCCACGCCAGACATCAAGTCCCATTATGCCTTCCGCATCTTTGACTTTGATGATGACGGAACCTTGAACAGAGAAGACCTGAGCCGGCTGGTGAACTGCCTCACGGGAGAGGGCGAGGACACACGGCTTAGTGCGTCTGAGATGAAGCAGCTCATCGACAACATCCTGGAGGAGTCTGACATTGACAGGGATGGAACCATCAACCTCTCTGAGTTCCAGCACGTCATCTCCCGTTCTCCAGACTTTGCCAGCTCCTTTAAGATTGTCCTGTGA
ORF Protein Sequence MGGSGSRLSKELLAEYQDLTFLTKQEILLAHRRFCELLPQEQRSVESSLRAQVPFEQILSLPELKANPFKERICRVFSTSPAKDSLSFEDFLDLLSVFSDTATPDIKSHYAFRIFDFDDDGTLNREDLSRLVNCLTGEGEDTRLSASEMKQLIDNILEESDIDRDGTINLSEFQHVISRSPDFASSFKIVL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP2055-Ab Anti-CIB1/ CIB/ CIBP monoclonal antibody
    Target Antigen GM-Tg-g-MP2055-Ag CIB1 VLP (virus-like particle)
    ORF Viral Vector pGMLP005192 Human CIB1 Lentivirus plasmid
    ORF Viral Vector vGMLP005192 Human CIB1 Lentivirus particle


    Target information

    Target ID GM-MP2055
    Target Name CIB1
    Gene Group Identifier
    （Target Gene ID in Homo species)         		10519
    Gene ID 100053632 (Equus caballus), 101088843 (Felis catus), 10519 (Homo sapiens), 23991 (Mus musculus)
    479044 (Canis lupus familiaris), 510141 (Bos taurus), 701842 (Macaca mulatta), 81823 (Rattus norvegicus)
    Gene Symbols & Synonyms CIB1,Cib1,CIB,EV3,CIBP,KIP1,PRKDCIP,SIP2-28,Kip,Cibkip,Prkdcip,Cib,Sip2-28
    Target Alternative Names CIB1,Calcium and integrin-binding protein 1,CIB,Calcium- and integrin-binding protein (CIBP), Calmyrin, DNA-PKcs-interacting protein, Kinase-interacting protein (KIP), SNK-interacting protein 2-28 (SIP2-28),CIB,EV3,CIBP,KIP1,PRKDCIP,SIP2-28
    Uniprot Accession Q17QE5,Q99828,Q9R010,Q9Z0F4
    Additional SwissProt Accessions: Q99828,Q9Z0F4,Q17QE5,Q9R010
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000018203, ENSG00000185043, ENSMUSG00000030538, ENSCAFG00845001241, ENSBTAG00000021275, ENSMMUG00000004376
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.