Human VSTM1/SIRL-1/SIRL1 ORF/cDNA clone-Lentivirus plasmid (NM_198481)

Cat. No.: pGMLP005052
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human VSTM1/SIRL-1/SIRL1 Lentiviral expression plasmid for VSTM1 lentivirus packaging, VSTM1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to VSTM1/SIRL-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $477.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP005052
Gene Name VSTM1
Accession Number NM_198481
Gene ID 284415
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 711 bp
Gene Alias SIRL-1,SIRL1,UNQ3033
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACCGCAGAATTCCTCTCCCTGCTTTGCCTCGGGCTGTGTCTGGGCTACGAAGATGAGAAAAAGAATGAGAAACCGCCCAAGCCCTCCCTCCACGCCTGGCCCAGCTCGGTGGTTGAAGCCGAGAGCAATGTGACCCTGAAGTGTCAGGCTCATTCCCAGAATGTGACATTTGTGCTGCGCAAGGTGAACGACTCTGGGTACAAGCAGGAACAGAGCTCGGCAGAAAACGAAGCTGAATTCCCCTTCACGGACCTGAAGCCTAAGGATGCTGGGAGGTACTTTTGTGCCTACAAGACAACAGCCTCCCATGAGTGGTCAGAAAGCAGTGAACACTTGCAGCTGGTGGTCACAGATAAACACGATGAACTTGAAGCTCCCTCAATGAAAACAGACACCAGAACCATCTTTGTCGCCATCTTCAGCTGCATCTCCATCCTTCTCCTCTTCCTCTCAGTCTTCATCATCTACAGATGCAGCCAGCACAGTTCATCATCTGAGGAATCCACCAAGAGAACCAGCCATTCCAAACTTCCGGAGCAGGAGGCTGCCGAGGCAGATTTATCCAATATGGAAAGGGTATCTCTCTCGACGGCAGACCCCCAAGGAGTGACCTATGCTGAGCTAAGCACCAGCGCCCTGTCTGAGGCAGCTTCAGACACCACCCAGGAGCCCCCAGGATCTCATGAATATGCGGCACTGAAAGTGTAG
ORF Protein Sequence MTAEFLSLLCLGLCLGYEDEKKNEKPPKPSLHAWPSSVVEAESNVTLKCQAHSQNVTFVLRKVNDSGYKQEQSSAENEAEFPFTDLKPKDAGRYFCAYKTTASHEWSESSEHLQLVVTDKHDELEAPSMKTDTRTIFVAIFSCISILLLFLSVFIIYRCSQHSSSSEESTKRTSHSKLPEQEAAEADLSNMERVSLSTADPQGVTYAELSTSALSEAASDTTQEPPGSHEYAALKV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0545-Ab Anti-VSTM1/ SIRL-1/ SIRL1 functional antibody
    Target Antigen GM-Tg-g-SE0545-Ag VSTM1 protein
    ORF Viral Vector pGMLP005052 Human VSTM1 Lentivirus plasmid
    ORF Viral Vector vGMLP005052 Human VSTM1 Lentivirus particle


    Target information

    Target ID GM-SE0545
    Target Name VSTM1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    284415
    Gene ID 100360054 (Rattus norvegicus), 284415 (Homo sapiens), 722757 (Macaca mulatta)
    Gene Symbols & Synonyms Vstm1,VSTM1,SIRL1,SIRL-1,UNQ3033
    Target Alternative Names SIRL-1,SIRL1,Signal inhibitory receptor on leukocytes-1 (SIRL-1),UNQ3033,V-set and transmembrane domain-containing protein 1,VSTM1,Vstm1
    Uniprot Accession Q6UX27
    Additional SwissProt Accessions: Q6UX27
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSG00000189068, ENSMMUG00000043110
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.