Human UPK3A/UP3A/UPIII ORF/cDNA clone-Lentivirus plasmid (NM_006953)

Cat. No.: pGMLP004984
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human UPK3A/UP3A/UPIII Lentiviral expression plasmid for UPK3A lentivirus packaging, UPK3A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to UPK3A/UP3A products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $516
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004984
Gene Name UPK3A
Accession Number NM_006953
Gene ID 7380
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 864 bp
Gene Alias UP3A,UPIII,UPIIIA,UPK3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCTCCGCTCTGGGCCCTGCTGGCCCTCGGCTGCCTGCGGTTCGGCTCGGCTGTGAACCTGCAGCCCCAACTGGCCAGTGTGACTTTCGCCACCAACAACCCCACACTTACCACTGTGGCCTTGGAAAAGCCTCTCTGCATGTTTGACAGCAAAGAGGCCCTCACTGGCACCCACGAGGTCTACCTGTATGTCCTGGTCGACTCAGCCATTTCCAGGAATGCCTCAGTGCAAGACAGCACCAACACCCCACTGGGCTCAACGTTCCTACAAACAGAGGGTGGGAGGACAGGTCCCTACAAAGCTGTGGCCTTTGACCTGATCCCCTGCAGTGACCTGCCCAGCCTGGATGCCATTGGGGATGTGTCCAAGGCCTCACAGATCCTGAATGCCTACCTGGTCAGGGTGGGTGCCAACGGGACCTGCCTGTGGGATCCCAACTTCCAGGGCCTCTGTAACGCACCCCTGTCGGCAGCCACGGAGTACAGGTTCAAGTATGTCCTGGTCAATATGTCCACGGGCTTGGTAGAGGACCAGACCCTGTGGTCAGACCCCATCCGCACCAACCAGCTCACCCCATACTCGACGATCGACACGTGGCCAGGCCGGCGGAGCGGAGGCATGATCGTCATCACTTCCATCCTGGGCTCCCTGCCCTTCTTTCTACTTGTGGGTTTTGCTGGCGCCATTGCCCTCAGCCTCGTGGACATGGGGAGTTCTGATGGGGAAACGACTCACGACTCCCAAATCACTCAGGAGGCTGTTCCCAAGTCGCTGGGGGCCTCGGAGTCTTCCTACACGTCCGTGAACCGGGGGCCGCCACTGGACAGGGCTGAGGTGTATTCCAGCAAGCTCCAAGACTGA
ORF Protein Sequence MPPLWALLALGCLRFGSAVNLQPQLASVTFATNNPTLTTVALEKPLCMFDSKEALTGTHEVYLYVLVDSAISRNASVQDSTNTPLGSTFLQTEGGRTGPYKAVAFDLIPCSDLPSLDAIGDVSKASQILNAYLVRVGANGTCLWDPNFQGLCNAPLSAATEYRFKYVLVNMSTGLVEDQTLWSDPIRTNQLTPYSTIDTWPGRRSGGMIVITSILGSLPFFLLVGFAGAIALSLVDMGSSDGETTHDSQITQEAVPKSLGASESSYTSVNRGPPLDRAEVYSSKLQD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP1908-Ab Anti-UPK3A/ UP3A/ UPIII monoclonal antibody
    Target Antigen GM-Tg-g-MP1908-Ag UPK3A VLP (virus-like particle)
    ORF Viral Vector pGMLP004984 Human UPK3A Lentivirus plasmid
    ORF Viral Vector vGMLP004984 Human UPK3A Lentivirus particle


    Target information

    Target ID GM-MP1908
    Target Name UPK3A
    Gene Group Identifier
    (Target Gene ID in Homo species)
    7380
    Gene ID 100052016 (Equus caballus), 100336102 (Bos taurus), 101088858 (Felis catus), 22270 (Mus musculus)
    315190 (Rattus norvegicus), 609118 (Canis lupus familiaris), 717456 (Macaca mulatta), 7380 (Homo sapiens)
    Gene Symbols & Synonyms UPK3A,Upk3a,UP3a,Upk3,UPIII,1110017C07Rik,UP3A,UPK3,UPIIIA
    Target Alternative Names 1110017C07Rik,UP3A,UP3a,UPIII,UPIIIA,UPK3,UPK3A,Upk3,Upk3a,Uroplakin III (UPIII),Uroplakin-3a
    Uniprot Accession O75631,P38574,Q9JKX8
    Additional SwissProt Accessions: P38574,Q9JKX8,O75631
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category
    Disease Malignant neoplasm of bladder
    Disease from KEGG Bladder cancer
    Gene Ensembl ENSECAG00000009125, ENSBTAG00000009913, ENSMUSG00000022435, ENSCAFG00845011106, ENSMMUG00000021900, ENSG00000100373
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.