Human TNFRSF6B/DCR3/DJ583P15.1.1 ORF/cDNA clone-Lentivirus plasmid (NM_003823)
Cat. No.: pGMLP004983
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human TNFRSF6B/DCR3/DJ583P15.1.1 Lentiviral expression plasmid for TNFRSF6B lentivirus packaging, TNFRSF6B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
TNFRSF6B/DCR3 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLP004983 |
| Gene Name | TNFRSF6B |
| Accession Number | NM_003823 |
| Gene ID | 8771 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 903 bp |
| Gene Alias | DCR3,DJ583P15.1.1,M68,M68E,TR6 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAGGGCGCTGGAGGGGCCAGGCCTGTCGCTGCTGTGCCTGGTGTTGGCGCTGCCTGCCCTGCTGCCGGTGCCGGCTGTACGCGGAGTGGCAGAAACACCCACCTACCCCTGGCGGGACGCAGAGACAGGGGAGCGGCTGGTGTGCGCCCAGTGCCCCCCAGGCACCTTTGTGCAGCGGCCGTGCCGCCGAGACAGCCCCACGACGTGTGGCCCGTGTCCACCGCGCCACTACACGCAGTTCTGGAACTACCTAGAGCGCTGCCGCTACTGCAACGTCCTCTGCGGGGAGCGTGAGGAGGAGGCACGGGCTTGCCACGCCACCCACAACCGTGCCTGCCGCTGCCGCACCGGCTTCTTCGCGCACGCTGGTTTCTGCTTGGAGCACGCATCGTGTCCACCTGGTGCCGGCGTGATTGCCCCGGGCACCCCCAGCCAGAACACGCAGTGCCAGCCGTGCCCCCCAGGCACCTTCTCAGCCAGCAGCTCCAGCTCAGAGCAGTGCCAGCCCCACCGCAACTGCACGGCCCTGGGCCTGGCCCTCAATGTGCCAGGCTCTTCCTCCCATGACACCCTGTGCACCAGCTGCACTGGCTTCCCCCTCAGCACCAGGGTACCAGGAGCTGAGGAGTGTGAGCGTGCCGTCATCGACTTTGTGGCTTTCCAGGACATCTCCATCAAGAGGCTGCAGCGGCTGCTGCAGGCCCTCGAGGCCCCGGAGGGCTGGGGTCCGACACCAAGGGCGGGCCGCGCGGCCTTGCAGCTGAAGCTGCGTCGGCGGCTCACGGAGCTCCTGGGGGCGCAGGACGGGGCGCTGCTGGTGCGGCTGCTGCAGGCGCTGCGCGTGGCCAGGATGCCCGGGCTGGAGCGGAGCGTCCGTGAGCGCTTCCTCCCTGTGCACTGA |
| ORF Protein Sequence | MRALEGPGLSLLCLVLALPALLPVPAVRGVAETPTYPWRDAETGERLVCAQCPPGTFVQRPCRRDSPTTCGPCPPRHYTQFWNYLERCRYCNVLCGEREEEARACHATHNRACRCRTGFFAHAGFCLEHASCPPGAGVIAPGTPSQNTQCQPCPPGTFSASSSSSEQCQPHRNCTALGLALNVPGSSSHDTLCTSCTGFPLSTRVPGAEECERAVIDFVAFQDISIKRLQRLLQALEAPEGWGPTPRAGRAALQLKLRRRLTELLGAQDGALLVRLLQALRVARMPGLERSVRERFLPVH |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE1344-Ab | Anti-TNF6B/ TNFRSF6B/ DCR3 functional antibody |
| Target Antigen | GM-Tg-g-SE1344-Ag | TNFRSF6B protein |
| Cytokine | cks-Tg-g-GM-SE1344 | tumor necrosis factor receptor superfamily, member 6b, decoy (TNFRSF6B) protein & antibody |
| ORF Viral Vector | pGMLP004983 | Human TNFRSF6B Lentivirus plasmid |
| ORF Viral Vector | vGMLP004983 | Human TNFRSF6B Lentivirus particle |
Target information
| Target ID | GM-SE1344 |
| Target Name | TNFRSF6B |
|
Gene Group Identifier (Target Gene ID in Homo species) |
8771 |
| Gene ID |
102899242 (Felis catus), 111770055 (Equus caballus), 114669829 (Macaca mulatta), 119865736 (Canis lupus familiaris) 789154 (Bos taurus), 8771 (Homo sapiens) |
| Gene Symbols & Synonyms | TNFRSF6B,M68,TR6,DCR3,M68E,DJ583P15.1.1 |
| Target Alternative Names | DCR3,DJ583P15.1.1,Decoy receptor 3 (DcR3),Decoy receptor for Fas ligand,M68,M68E,TNFRSF6B,TR6,Tumor necrosis factor receptor superfamily member 6B |
| Uniprot Accession |
O95407
Additional SwissProt Accessions: O95407 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Cytokine Target |
| Disease | cancer, Colon Cancer |
| Disease from KEGG | Cytokine-cytokine receptor interaction |
| Gene Ensembl | ENSECAG00000032390, ENSMMUG00000045470, ENSCAFG00845018187, ENSBTAG00000007498, ENSG00000243509 |
| Target Classification |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


