Human CD1A/CD1/FCB6 ORF/cDNA clone-Lentivirus plasmid (NM_001763)

Cat. No.: pGMLP004956
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CD1A/CD1/FCB6 Lentiviral expression plasmid for CD1A lentivirus packaging, CD1A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to CD1A/CD1a/CD1A/CD1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $546
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004956
Gene Name CD1A
Accession Number NM_001763
Gene ID 909
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 984 bp
Gene Alias CD1,FCB6,HTA1,R4,T6
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGTTTTTGCTACTTCCATTGTTAGCTGTTCTCCCAGGTGATGGCAATGCAGACGGGCTCAAGGAGCCTCTCTCCTTCCATGTCACCTGGATCGCATCCTTTTACAACCATTCCTGGAAACAAAATCTGGTCTCAGGTTGGCTGAGTGATTTGCAGACTCATACCTGGGACAGCAATTCCAGCACCATCGTTTTCCTGTGCCCCTGGTCCAGGGGAAACTTCAGCAATGAGGAGTGGAAGGAACTGGAAACATTATTCCGTATACGCACCATTCGGTCATTTGAGGGAATTCGTAGATACGCCCATGAATTGCAGTTTGAATATCCTTTTGAGATACAGGTGACAGGAGGCTGTGAGCTGCACTCTGGAAAGGTCTCAGGAAGCTTCTTGCAGTTAGCTTATCAAGGATCAGACTTTGTGAGCTTCCAGAACAATTCATGGTTGCCATATCCAGTGGCTGGGAATATGGCCAAGCATTTCTGCAAAGTGCTCAATCAGAATCAGCATGAAAATGACATAACACACAATCTTCTCAGTGACACCTGCCCACGTTTCATCTTGGGTCTTCTTGATGCAGGAAAGGCACATCTCCAGCGGCAAGTGAAGCCCGAGGCCTGGCTGTCCCATGGCCCCAGTCCTGGCCCTGGCCATCTGCAGCTTGTGTGCCATGTCTCAGGATTCTACCCAAAGCCCGTGTGGGTGATGTGGATGCGGGGTGAGCAGGAGCAGCAGGGCACTCAGCGAGGGGACATCTTGCCCAGTGCTGATGGGACATGGTATCTCCGCGCAACCCTGGAGGTGGCCGCTGGGGAGGCAGCTGACCTGTCCTGTCGGGTGAAGCACAGCAGTCTAGAGGGCCAGGACATCGTCCTCTACTGGGAGCATCACAGTTCCGTGGGCTTCATCATCTTGGCGGTGATAGTGCCTTTACTTCTTCTGATAGGTCTTGCGCTTTGGTTCAGGAAACGCTGTTTCTGTTAA
ORF Protein Sequence MLFLLLPLLAVLPGDGNADGLKEPLSFHVTWIASFYNHSWKQNLVSGWLSDLQTHTWDSNSSTIVFLCPWSRGNFSNEEWKELETLFRIRTIRSFEGIRRYAHELQFEYPFEIQVTGGCELHSGKVSGSFLQLAYQGSDFVSFQNNSWLPYPVAGNMAKHFCKVLNQNQHENDITHNLLSDTCPRFILGLLDAGKAHLQRQVKPEAWLSHGPSPGPGHLQLVCHVSGFYPKPVWVMWMRGEQEQQGTQRGDILPSADGTWYLRATLEVAAGEAADLSCRVKHSSLEGQDIVLYWEHHSSVGFIILAVIVPLLLLIGLALWFRKRCFC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T60433-Ab Anti-CD1A/ CD1/ FCB6 monoclonal antibody
    Target Antigen GM-Tg-g-T60433-Ag CD1A VLP (virus-like particle)
    ORF Viral Vector pGMLP004956 Human CD1A Lentivirus plasmid
    ORF Viral Vector vGMLP004956 Human CD1A Lentivirus particle


    Target information

    Target ID GM-T60433
    Target Name CD1A/CD1a
    Gene Group Identifier
    (Target Gene ID in Homo species)
    909
    Gene ID 100054902 (Equus caballus), 698438 (Macaca mulatta), 909 (Homo sapiens)
    Gene Symbols & Synonyms CD1A,CD1A1,R4,T6,CD1,FCB6,HTA1
    Target Alternative Names CD1,CD1A,CD1A1,CD1a,FCB6,HTA1,R4,T-cell surface antigen T6/Leu-6 (hTa1 thymocyte antigen),T-cell surface glycoprotein CD1a,T6
    Uniprot Accession P06126
    Additional SwissProt Accessions: P06126
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease cancer, Breast Cancer
    Disease from KEGG Tight junction, Hematopoietic cell lineage, Amoebiasis
    Gene Ensembl ENSECAG00000037237, ENSMMUG00000062253, ENSG00000158477
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.