Human CFD/ADIPSIN/ADN ORF/cDNA clone-Lentivirus plasmid (NM_001317335)
Cat. No.: pGMLP004900
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human CFD/ADIPSIN/ADN Lentiviral expression plasmid for CFD lentivirus packaging, CFD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
Complement factor D/CFD/CFD/ADIPSIN products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLP004900 |
| Gene Name | CFD |
| Accession Number | NM_001317335 |
| Gene ID | 1675 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 783 bp |
| Gene Alias | ADIPSIN,ADN,DF,PFD |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGCACAGCTGGGAGCGCCTGGCAGTTCTGGTCCTCCTAGGAGCGGCCGCCTGCGGTGAGGAGGCCTGGGCCTGGGCGGCGCCGCCCCGTGGTCGGATCCTGGGCGGCAGAGAGGCCGAGGCGCACGCGCGGCCCTACATGGCGTCGGTGCAGCTGAACGGCGCGCACCTGTGCGGCGGCGTCCTGGTGGCGGAGCAGTGGGTGCTGAGCGCGGCGCACTGCCTGGAGGACGCGGCCGACGGGAAGGTGCAGGTTCTCCTGGGCGCGCACTCCCTGTCGCAGCCGGAGCCCTCCAAGCGCCTGTACGACGTGCTCCGCGCAGTGCCCCACCCGGACAGCCAGCCCGACACCATCGACCACGACCTCCTGCTGCTACAGCTGTCGGAGAAGGCCACACTGGGCCCTGCTGTGCGCCCCCTGCCCTGGCAGCGCGTGGACCGCGACGTGGCACCGGGAACTCTCTGCGACGTGGCCGGCTGGGGCATAGTCAACCACGCGGGCCGCCGCCCGGACAGCCTGCAGCACGTGCTCTTGCCAGTGCTGGACCGCGCCACCTGCAACCGGCGCACGCACCACGACGGCGCCATCACCGAGCGCTTGATGTGCGCGGAGAGCAATCGCCGGGACAGCTGCAAGGGTGACTCCGGGGGCCCGCTGGTGTGCGGGGGCGTGCTCGAGGGCGTGGTCACCTCGGGCTCGCGCGTTTGCGGCAACCGCAAGAAGCCCGGGATCTACACCCGCGTGGCGAGCTATGCGGCCTGGATCGACAGCGTCCTGGCCTAG |
| ORF Protein Sequence | MHSWERLAVLVLLGAAACGEEAWAWAAPPRGRILGGREAEAHARPYMASVQLNGAHLCGGVLVAEQWVLSAAHCLEDAADGKVQVLLGAHSLSQPEPSKRLYDVLRAVPHPDSQPDTIDHDLLLLQLSEKATLGPAVRPLPWQRVDRDVAPGTLCDVAGWGIVNHAGRRPDSLQHVLLPVLDRATCNRRTHHDGAITERLMCAESNRRDSCKGDSGGPLVCGGVLEGVVTSGSRVCGNRKKPGIYTRVASYAAWIDSVLA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Biosimilar | GMP-Bios-ab-293 | Pre-Made Lampalizumab biosimilar, Fab, Anti-CFD Antibody: Anti-ADIPSIN/ADN/DF/PFD therapeutic antibody |
| Target Antibody | GM-Tg-g-T66383-Ab | Anti-CFAD/ CFD/ ADIPSIN functional antibody |
| Target Antigen | GM-Tg-g-T66383-Ag | CFD protein |
| Cytokine | cks-Tg-g-GM-T66383 | complement factor D (adipsin) (CFD) protein & antibody |
| ORF Viral Vector | pGMLP004900 | Human CFD Lentivirus plasmid |
| ORF Viral Vector | vGMLP004900 | Human CFD Lentivirus particle |
Target information
| Target ID | GM-T66383 |
| Target Name | Complement factor D/CFD |
|
Gene Group Identifier (Target Gene ID in Homo species) |
1675 |
| Gene ID |
101093500 (Felis catus), 111774154 (Equus caballus), 11537 (Mus musculus), 1675 (Homo sapiens) 485095 (Canis lupus familiaris), 505647 (Bos taurus), 54249 (Rattus norvegicus), 721138 (Macaca mulatta) |
| Gene Symbols & Synonyms | CFD,Cfd,DF,Adn,ADN,PFD,ADIPSIN,Df,EVE |
| Target Alternative Names | ADIPSIN,ADN,Adipsin,Adn,C3 convertase activator,CFD,Cfd,Complement factor D,DF,Df,EVE,PFD,Properdin factor D |
| Uniprot Accession |
P00746,P03953,P32038,Q3T0A3
Additional SwissProt Accessions: P03953,P00746,Q3T0A3,P32038 |
| Uniprot Entry Name | |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target, INN Index, Cytokine Target |
| Disease | Dent disease |
| Disease from KEGG | Complement and coagulation cascades, Staphylococcus aureus infection |
| Gene Ensembl | ENSECAG00000036123, ENSMUSG00000061780, ENSG00000197766, ENSCAFG00845014517, ENSBTAG00000048122, ENSMMUG00000028947 |
| Target Classification |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


