Human HDGF/HMG1L2 ORF/cDNA clone-Lentivirus plasmid (NM_001319186)

Cat. No.: pGMLP004865
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HDGF/HMG1L2 Lentiviral expression plasmid for HDGF lentivirus packaging, HDGF lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to HDGF/HMG1L2 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $498
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004865
Gene Name HDGF
Accession Number NM_001319186
Gene ID 3068
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 792 bp
Gene Alias HMG1L2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCACCCGGAAGGTGGCCAATTTGTGCCTCAACTCCTTGGCCATCTCCTGGCTACCAAACTCAAGCGTTTCCTCCTTAGCAAAGGCGGACGTAGGGCTCAAATCCCCGACGTTTCCAGGGCCACCCCCCATACGATTGACGAGATGCCTGAGGCTGCCGTGAAATCAACAGCCAACAAATACCAAGTCTTTTTTTTCGGGACCCACGAGACGGCATTCCTGGGCCCCAAAGACCTCTTCCCTTACGAGGAATCCAAGGAGAAGTTTGGCAAGCCCAACAAGAGGAAAGGGTTCAGCGAGGGGCTGTGGGAGATCGAGAACAACCCTACTGTCAAGGCTTCCGGCTATCAGCCTGTGCTGTCTCTGCTGCAGTCCTCCCAGAAAAAGAGCTGTGTGGAAGAGCCTGAACCAGAGCCCGAAGCTGCAGAGGGTGACGGTGATAAGAAGGGGAATGCAGAGGGCAGCAGCGACGAGGAAGGGAAGCTGGTCATTGATGAGCCAGCCAAGGAGAAGAACGAGAAAGGAGCGTTGAAGAGGAGAGCAGGGGACTTGCTGGAGGACTCTCCTAAACGTCCCAAGGAGGCAGAAAACCCTGAAGGAGAGGAGAAGGAGGCAGCCACCTTGGAGGTTGAGAGGCCCCTTCCTATGGAGGTGGAAAAGAATAGCACCCCCTCTGAGCCCGGCTCTGGCCGGGGGCCTCCCCAAGAGGAAGAAGAGGAGGAGGATGAAGAGGAAGAGGCTACCAAGGAAGATGCTGAGGCCCCAGGCATCAGAGATCATGAGAGCCTGTAG
ORF Protein Sequence MHPEGGQFVPQLLGHLLATKLKRFLLSKGGRRAQIPDVSRATPHTIDEMPEAAVKSTANKYQVFFFGTHETAFLGPKDLFPYEESKEKFGKPNKRKGFSEGLWEIENNPTVKASGYQPVLSLLQSSQKKSCVEEPEPEPEAAEGDGDKKGNAEGSSDEEGKLVIDEPAKEKNEKGALKRRAGDLLEDSPKRPKEAENPEGEEKEAATLEVERPLPMEVEKNSTPSEPGSGRGPPQEEEEEEDEEEEATKEDAEAPGIRDHESL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T84341-Ab Anti-HDGF/ HMG1L2 functional antibody
    Target Antigen GM-Tg-g-T84341-Ag HDGF protein
    ORF Viral Vector pGMLP004865 Human HDGF Lentivirus plasmid
    ORF Viral Vector vGMLP004865 Human HDGF Lentivirus particle


    Target information

    Target ID GM-T84341
    Target Name HDGF
    Gene Group Identifier
    (Target Gene ID in Homo species)
    3068
    Gene ID 100064506 (Equus caballus), 100856751 (Canis lupus familiaris), 101082623 (Felis catus), 114499 (Rattus norvegicus)
    15191 (Mus musculus), 3068 (Homo sapiens), 327953 (Bos taurus), 716742 (Macaca mulatta)
    Gene Symbols & Synonyms HDGF,Hdgf,D3Ertd299e,HMG1L2
    Target Alternative Names D3Ertd299e,HDGF,HMG1L2,Hdgf,Hepatoma-derived growth factor,High mobility group protein 1-like 2 (HMG-1L2)
    Uniprot Accession P51858,P51859,Q8VHK7,Q9XSK7
    Additional SwissProt Accessions: Q8VHK7,P51859,P51858,Q9XSK7
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG
    Gene Ensembl ENSECAG00000011178, ENSCAFG00845008237, ENSMUSG00000004897, ENSG00000143321, ENSBTAG00000039793, ENSMMUG00000040660
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.