Human POMC/ACTH/CLIP ORF/cDNA clone-Lentivirus plasmid (NM_001035256)

Cat. No.: pGMLP004805
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human POMC/ACTH/CLIP Lentiviral expression plasmid for POMC lentivirus packaging, POMC lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to POMC/ACTH products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $501
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004805
Gene Name POMC
Accession Number NM_001035256
Gene ID 5443
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 804 bp
Gene Alias ACTH,CLIP,LPH,MSH,NPP,POC
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCGAGATCGTGCTGCAGCCGCTCGGGGGCCCTGTTGCTGGCCTTGCTGCTTCAGGCCTCCATGGAAGTGCGTGGCTGGTGCCTGGAGAGCAGCCAGTGTCAGGACCTCACCACGGAAAGCAACCTGCTGGAGTGCATCCGGGCCTGCAAGCCCGACCTCTCGGCCGAGACTCCCATGTTCCCGGGAAATGGCGACGAGCAGCCTCTGACCGAGAACCCCCGGAAGTACGTCATGGGCCACTTCCGCTGGGACCGATTCGGCCGCCGCAACAGCAGCAGCAGCGGCAGCAGCGGCGCAGGGCAGAAGCGCGAGGACGTCTCAGCGGGCGAAGACTGCGGCCCGCTGCCTGAGGGCGGCCCCGAGCCCCGCAGCGATGGTGCCAAGCCGGGCCCGCGCGAGGGCAAGCGCTCCTACTCCATGGAGCACTTCCGCTGGGGCAAGCCGGTGGGCAAGAAGCGGCGCCCAGTGAAGGTGTACCCTAACGGCGCCGAGGACGAGTCGGCCGAGGCCTTCCCCCTGGAGTTCAAGAGGGAGCTGACTGGCCAGCGACTCCGGGAGGGAGATGGCCCCGACGGCCCTGCCGATGACGGCGCAGGGGCCCAGGCCGACCTGGAGCACAGCCTGCTGGTGGCGGCCGAGAAGAAGGACGAGGGCCCCTACAGGATGGAGCACTTCCGCTGGGGCAGCCCGCCCAAGGACAAGCGCTACGGCGGTTTCATGACCTCCGAGAAGAGCCAGACGCCCCTGGTGACGCTGTTCAAAAACGCCATCATCAAGAACGCCTACAAGAAGGGCGAGTGA
ORF Protein Sequence MPRSCCSRSGALLLALLLQASMEVRGWCLESSQCQDLTTESNLLECIRACKPDLSAETPMFPGNGDEQPLTENPRKYVMGHFRWDRFGRRNSSSSGSSGAGQKREDVSAGEDCGPLPEGGPEPRSDGAKPGPREGKRSYSMEHFRWGKPVGKKRRPVKVYPNGAEDESAEAFPLEFKRELTGQRLREGDGPDGPADDGAGAQADLEHSLLVAAEKKDEGPYRMEHFRWGSPPKDKRYGGFMTSEKSQTPLVTLFKNAIIKNAYKKGE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T62912-Ab Anti-COLI/ POMC/ ACTH functional antibody
    Target Antigen GM-Tg-g-T62912-Ag POMC protein
    ORF Viral Vector pGMLP004805 Human POMC Lentivirus plasmid
    ORF Viral Vector vGMLP004805 Human POMC Lentivirus particle


    Target information

    Target ID GM-T62912
    Target Name POMC
    Gene Group Identifier
    (Target Gene ID in Homo species)
    5443
    Gene ID 100071524 (Equus caballus), 101087223 (Felis catus), 18976 (Mus musculus), 24664 (Rattus norvegicus)
    281416 (Bos taurus), 403659 (Canis lupus familiaris), 5443 (Homo sapiens), 694430 (Macaca mulatta)
    Gene Symbols & Synonyms POMC,Pomc,ACTH,alpha-MSH,BE,Npp,Clip,Pomc1,Pomc-1,Beta-LPH,alphaMSH,beta-MSH,Gamma-LPH,gamma-MSH,Pomc2,LPH,MSH,NPP,POC,CLIP,OBAIRH
    Target Alternative Names ACTH,BE,Beta-LPH,CLIP,Clip,Corticotropin-lipotropin,Gamma-LPH,LPH,MSH,NPP,Npp,OBAIRH,POC,POMC,Pomc,Pomc-1,Pomc1,Pomc2,Pro-opiomelanocortin,alpha-MSH,alphaMSH,beta-MSH,gamma-MSH
    Uniprot Accession P01189,P01190,P01193,P01194
    Additional SwissProt Accessions: P01193,P01194,P01190,P01189
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Diagnostics Biomarker
    Disease cancer
    Disease from KEGG cAMP signaling pathway, Neuroactive ligand-receptor interaction, Melanogenesis, Adipocytokine signaling pathway, Aldosterone synthesis and secretion, Cortisol synthesis and secretion, Cushing syndrome
    Gene Ensembl ENSMUSG00000020660, ENSBTAG00000007897, ENSCAFG00845026092, ENSG00000115138, ENSMMUG00000055135
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.