Human MGP/GIG36/MGLAP ORF/cDNA clone-Lentivirus plasmid (NM_001190839)

Cat. No.: pGMLP004798
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MGP/GIG36/MGLAP Lentiviral expression plasmid for MGP lentivirus packaging, MGP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to MGP/GIG36 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004798
Gene Name MGP
Accession Number NM_001190839
Gene ID 4256
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 387 bp
Gene Alias GIG36,MGLAP,NTI
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGAGCCTGATCCTTCTTGCCATCCTGGCCGCCTTAGCGGTAGTAACTTTGTGTTATGGAGAGTGGCAGAAAGAAGAAAACTTCGGCTTTGATATCGTTTCAGTTCTCTCTCTGAACTGGCATCGTGCCCAGGAATCACATGAAAGCATGGAATCTTATGAACTTAATCCCTTCATTAACAGGAGAAATGCAAATACCTTCATATCCCCTCAGCAGAGATGGAGAGCTAAAGTCCAAGAGAGGATCCGAGAACGCTCTAAGCCTGTCCACGAGCTCAATAGGGAAGCCTGTGATGACTACAGACTTTGCGAACGCTACGCCATGGTTTATGGATACAATGCTGCCTATAATCGCTACTTCAGGAAGCGCCGAGGGACCAAATGA
ORF Protein Sequence MKSLILLAILAALAVVTLCYGEWQKEENFGFDIVSVLSLNWHRAQESHESMESYELNPFINRRNANTFISPQQRWRAKVQERIRERSKPVHELNREACDDYRLCERYAMVYGYNAAYNRYFRKRRGTK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1099-Ab Anti-MGP/ GIG36/ MGLAP functional antibody
    Target Antigen GM-Tg-g-SE1099-Ag MGP protein
    ORF Viral Vector pGMLP004798 Human MGP Lentivirus plasmid
    ORF Viral Vector vGMLP004798 Human MGP Lentivirus particle


    Target information

    Target ID GM-SE1099
    Target Name MGP
    Gene Group Identifier
    (Target Gene ID in Homo species)
    4256
    Gene ID 100063934 (Equus caballus), 100856382 (Canis lupus familiaris), 101096741 (Felis catus), 17313 (Mus musculus)
    25333 (Rattus norvegicus), 282660 (Bos taurus), 4256 (Homo sapiens), 574116 (Macaca mulatta)
    Gene Symbols & Synonyms MGP,Mgp,Mglap,NTI,GIG36,MGLAP
    Target Alternative Names Cell growth-inhibiting gene 36 protein,GIG36,MGLAP,MGP,Matrix Gla protein,Mglap,Mgp,NTI
    Uniprot Accession P07507,P08493,P08494,P19788
    Additional SwissProt Accessions: P19788,P08494,P07507,P08493
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSCAFG00845021156, ENSMUSG00000030218, ENSG00000111341, ENSMMUG00000047247
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.