Human CCL23/CK-BETA-8/Ckb-8 ORF/cDNA clone-Lentivirus plasmid (NM_145898)

Cat. No.: pGMLP004762
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CCL23/CK-BETA-8/Ckb-8 Lentiviral expression plasmid for CCL23 lentivirus packaging, CCL23 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CCL23/CK-BETA-8 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004762
Gene Name CCL23
Accession Number NM_145898
Gene ID 6368
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 363 bp
Gene Alias CK-BETA-8,Ckb-8,Ckb-8-1,CKb8,hmrp-2a,MIP-3,MIP3,MPIF-1,SCYA23
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGGTCTCCGTGGCTGCCCTCTCCTGCCTCATGCTTGTTACTGCCCTTGGATCCCAGGCCCGGGTCACAAAAGATGCAGAGACAGAGTTCATGATGTCAAAGCTTCCATTGGAAAATCCAGTACTTCTGGACAGATTCCATGCTACTAGTGCTGACTGCTGCATCTCCTACACCCCACGAAGCATCCCGTGTTCACTCCTGGAGAGTTACTTTGAAACGAACAGCGAGTGCTCCAAGCCGGGTGTCATCTTCCTCACCAAGAAGGGGCGACGTTTCTGTGCCAACCCCAGTGATAAGCAAGTTCAGGTTTGCATGAGAATGCTGAAGCTGGACACACGGATCAAGACCAGGAAGAATTGA
ORF Protein Sequence MKVSVAALSCLMLVTALGSQARVTKDAETEFMMSKLPLENPVLLDRFHATSADCCISYTPRSIPCSLLESYFETNSECSKPGVIFLTKKGRRFCANPSDKQVQVCMRMLKLDTRIKTRKN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T23934-Ab Anti-CCL23/ CK-BETA-8/ CKb8 functional antibody
    Target Antigen GM-Tg-g-T23934-Ag CCL23 protein
    Cytokine cks-Tg-g-GM-T23934 chemokine (C-C motif) ligand 23 (CCL23) protein & antibody
    ORF Viral Vector pGMLP004762 Human CCL23 Lentivirus plasmid
    ORF Viral Vector vGMLP004762 Human CCL23 Lentivirus particle


    Target information

    Target ID GM-T23934
    Target Name CCL23
    Gene Group Identifier
    （Target Gene ID in Homo species)         		6368
    Gene ID 6368 (Homo sapiens)
    Gene Symbols & Synonyms CCL23,CKb8,MIP3,Ckb-8,MIP-3,MPIF-1,SCYA23,Ckb-8-1,hmrp-2a,CK-BETA-8
    Target Alternative Names C-C motif chemokine 23,CCL23,CK-BETA-8,CK-beta-8 (CKB-8),CKb8,Ckb-8,Ckb-8-1,MIP-3,MIP3,MPIF-1,Macrophage inflammatory protein 3 (MIP-3),Myeloid progenitor inhibitory factor 1 (MPIF-1),SCYA23,Small-inducible cytokine A23,hmrp-2a
    Uniprot Accession P55773
    Additional SwissProt Accessions: P55773
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Cytokine Target
    Disease
    Disease from KEGG Cytokine-cytokine receptor interaction, Viral protein interaction with cytokine and cytokine receptor, Chemokine signaling pathway
    Gene Ensembl ENSG00000274736
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.