Human HSPB3/DHMN2C/HMN2C ORF/cDNA clone-Lentivirus plasmid (NM_006308)

Cat. No.: pGMLP004699
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human HSPB3/DHMN2C/HMN2C Lentiviral expression plasmid for HSPB3 lentivirus packaging, HSPB3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to HSPB3/HSP27/HSPB3/DHMN2C products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004699
Gene Name HSPB3
Accession Number NM_006308
Gene ID 8988
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 453 bp
Gene Alias DHMN2C,HMN2C,HSPL27
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAAAAATCATTTTGAGGCACCTCATAGAGATTCCAGTGCGTTACCAGGAAGAGTTTGAAGCTCGAGGTCTAGAAGACTGCAGGCTGGATCATGCTTTATATGCACTGCCTGGGCCAACCATCGTGGACCTGAGGAAAACCAGGGCAGCGCAGTCTCCTCCAGTGGACTCAGCGGCAGAGACGCCACCCCGAGAAGGCAAATCCCACTTTCAGATCCTGCTGGACGTGGTCCAGTTCCTCCCTGAAGACATCATCATTCAGACCTTCGAAGGCTGGCTGCTGATAAAAGCACAACACGGAACCAGAATGGATGAGCACGGTTTTATCTCAAGAAGCTTCACCCGACAGTACAAACTACCAGATGGTGTGGAAATCAAAGATTTGTCTGCAGTCCTCTGTCATGATGGAATTTTGGTGGTGGAAGTAAAGGATCCAGTTGGGACTAAGTGA
ORF Protein Sequence MAKIILRHLIEIPVRYQEEFEARGLEDCRLDHALYALPGPTIVDLRKTRAAQSPPVDSAAETPPREGKSHFQILLDVVQFLPEDIIIQTFEGWLLIKAQHGTRMDEHGFISRSFTRQYKLPDGVEIKDLSAVLCHDGILVVEVKDPVGTK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T68517-Ab Anti-HSP27 monoclonal antibody
    Target Antigen GM-Tg-g-T68517-Ag HSP27/HSPB3 protein
    ORF Viral Vector pGMLP004699 Human HSPB3 Lentivirus plasmid
    ORF Viral Vector vGMLP004699 Human HSPB3 Lentivirus particle


    Target information

    Target ID GM-T68517
    Target Name HSPB3/HSP27
    Gene Group Identifier
    (Target Gene ID in Homo species)
    8988
    Gene ID 100052250 (Equus caballus), 101088721 (Felis catus), 102156019 (Canis lupus familiaris), 56534 (Mus musculus)
    616007 (Bos taurus), 704576 (Macaca mulatta), 78951 (Rattus norvegicus), 8988 (Homo sapiens)
    Gene Symbols & Synonyms HSPB3,Hspb3,spb3,Hsbp3,2310035K17Rik,HMN2C,HMND4,DHMN2C,HSPL27
    Target Alternative Names 2310035K17Rik,DHMN2C,HMN2C,HMND4,HSP27,HSPB3,HSPL27,Heat shock 17 kDa protein (HSP 17),Heat shock protein beta-3,Heat shock protein family B member 3,Hsbp3,HspB3,Hspb3,Protein 3,spb3
    Uniprot Accession Q12988,Q2KHU9,Q9QZ57,Q9QZ58
    Additional SwissProt Accessions: Q9QZ57,Q2KHU9,Q9QZ58,Q12988
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000004498, ENSMUSG00000051456, ENSBTAG00000022714, ENSMMUG00000018488, ENSG00000169271
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.