Human SIGLEC15/CD33L3/HsT1361 ORF/cDNA clone-Lentivirus plasmid (NM_213602)
Cat. No.: pGMLP004687
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human SIGLEC15/CD33L3/HsT1361 Lentiviral expression plasmid for SIGLEC15 lentivirus packaging, SIGLEC15 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
Siglec-15/SIGLEC15/SIGLEC15/CD33L3 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLP004687 |
| Gene Name | SIGLEC15 |
| Accession Number | NM_213602 |
| Gene ID | 284266 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 987 bp |
| Gene Alias | CD33L3,HsT1361,SIGLEC-15 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGAAAAGTCCATCTGGCTGCTGGCCTGCTTGGCGTGGGTTCTCCCGACAGGCTCATTTGTGAGAACTAAAATAGATACTACGGAGAACTTGCTCAACACAGAGGTGCACAGCTCGCCAGCGCAGCGCTGGTCCATGCAGGTGCCACCCGAGGTGAGCGCGGAGGCAGGCGACGCGGCAGTGCTGCCCTGCACCTTCACGCACCCGCACCGCCACTACGACGGGCCGCTGACGGCCATCTGGCGCGCGGGCGAGCCCTATGCGGGCCCGCAGGTGTTCCGCTGCGCTGCGGCGCGGGGCAGCGAGCTCTGCCAGACGGCGCTGAGCCTGCACGGCCGCTTCCGGCTGCTGGGCAACCCGCGCCGCAACGACCTCTCGCTGCGCGTCGAGCGCCTCGCCCTGGCTGACGACCGCCGCTACTTCTGCCGCGTCGAGTTCGCCGGCGACGTCCATGACCGCTACGAGAGCCGCCACGGCGTCCGGCTGCACGTGACAGCCGCGCCGCGGATCGTCAACATCTCGGTGCTGCCCAGTCCGGCTCACGCCTTCCGCGCGCTCTGCACTGCCGAAGGGGAGCCGCCGCCCGCCCTCGCCTGGTCCGGCCCGGCCCTGGGCAACAGCTTGGCAGCCGTGCGGAGCCCGCGTGAGGGTCACGGCCACCTAGTGACCGCCGAACTGCCCGCACTGACCCATGACGGCCGCTACACGTGTACGGCCGCCAACAGCCTGGGCCGCTCCGAGGCCAGCGTCTACCTGTTCCGCTTCCATGGCGCCAGCGGGGCCTCGACGGTCGCCCTCCTGCTCGGCGCTCTCGGCTTCAAGGCGCTGCTGCTGCTCGGGGTCCTGGCCGCCCGCGCTGCCCGCCGCCGCCCAGAGCATCTGGACACCCCGGACACCCCACCACGGTCCCAGGCCCAGGAGTCCAATTATGAAAATTTGAGCCAGATGAACCCCCGGAGCCCACCAGCCACCATGTGCTCACCGTGA |
| ORF Protein Sequence | MEKSIWLLACLAWVLPTGSFVRTKIDTTENLLNTEVHSSPAQRWSMQVPPEVSAEAGDAAVLPCTFTHPHRHYDGPLTAIWRAGEPYAGPQVFRCAAARGSELCQTALSLHGRFRLLGNPRRNDLSLRVERLALADDRRYFCRVEFAGDVHDRYESRHGVRLHVTAAPRIVNISVLPSPAHAFRALCTAEGEPPPALAWSGPALGNSLAAVRSPREGHGHLVTAELPALTHDGRYTCTAANSLGRSEASVYLFRFHGASGASTVALLLGALGFKALLLLGVLAARAARRRPEHLDTPDTPPRSQAQESNYENLSQMNPRSPPATMCSP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T85507-Ab | Anti-SIG15/ SIGLEC15/ CD33L3 monoclonal antibody |
| Target Antigen | GM-Tg-g-T85507-Ag | SIGLEC15 VLP (virus-like particle) |
| ORF Viral Vector | pGMLP004687 | Human SIGLEC15 Lentivirus plasmid |
| ORF Viral Vector | vGMLP004687 | Human SIGLEC15 Lentivirus particle |
Target information
| Target ID | GM-T85507 |
| Target Name | Siglec-15/SIGLEC15 |
|
Gene Group Identifier (Target Gene ID in Homo species) |
284266 |
| Gene ID |
100068715 (Equus caballus), 100855945 (Canis lupus familiaris), 101084655 (Felis catus), 284266 (Homo sapiens) 498888 (Rattus norvegicus), 522776 (Bos taurus), 620235 (Mus musculus), 700656 (Macaca mulatta) |
| Gene Symbols & Synonyms | SIGLEC15,Siglec15,CD33L3,HsT1361,SIGLEC-15,RGD1565948,Cd33l3,EG620235,SIGLEC-I |
| Target Alternative Names | CD33 antigen-like 3,CD33L3,Cd33l3,EG620235,HsT1361,RGD1565948,SIGLEC-15,SIGLEC-I,SIGLEC15,Sialic acid-binding Ig-like lectin 15,Siglec-15,Siglec15 |
| Uniprot Accession |
Q6ZMC9
Additional SwissProt Accessions: Q6ZMC9 |
| Uniprot Entry Name | |
| Protein Sub-location | Transmembrane Protein |
| Category | Therapeutics Target, Immuno-oncology Target |
| Disease | |
| Disease from KEGG | |
| Gene Ensembl | ENSECAG00000018025, ENSCAFG00845003447, ENSG00000197046, ENSBTAG00000016620, ENSMUSG00000091055, ENSMMUG00000003561 |
| Target Classification | Checkpoint-Immuno Oncology |
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


