Human SIGLEC15/CD33L3/HsT1361 ORF/cDNA clone-Lentivirus plasmid (NM_213602)

Cat. No.: pGMLP004687
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SIGLEC15/CD33L3/HsT1361 Lentiviral expression plasmid for SIGLEC15 lentivirus packaging, SIGLEC15 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to Siglec-15/SIGLEC15/SIGLEC15/CD33L3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $546.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004687
Gene Name SIGLEC15
Accession Number NM_213602
Gene ID 284266
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 987 bp
Gene Alias CD33L3,HsT1361,SIGLEC-15
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAAAAGTCCATCTGGCTGCTGGCCTGCTTGGCGTGGGTTCTCCCGACAGGCTCATTTGTGAGAACTAAAATAGATACTACGGAGAACTTGCTCAACACAGAGGTGCACAGCTCGCCAGCGCAGCGCTGGTCCATGCAGGTGCCACCCGAGGTGAGCGCGGAGGCAGGCGACGCGGCAGTGCTGCCCTGCACCTTCACGCACCCGCACCGCCACTACGACGGGCCGCTGACGGCCATCTGGCGCGCGGGCGAGCCCTATGCGGGCCCGCAGGTGTTCCGCTGCGCTGCGGCGCGGGGCAGCGAGCTCTGCCAGACGGCGCTGAGCCTGCACGGCCGCTTCCGGCTGCTGGGCAACCCGCGCCGCAACGACCTCTCGCTGCGCGTCGAGCGCCTCGCCCTGGCTGACGACCGCCGCTACTTCTGCCGCGTCGAGTTCGCCGGCGACGTCCATGACCGCTACGAGAGCCGCCACGGCGTCCGGCTGCACGTGACAGCCGCGCCGCGGATCGTCAACATCTCGGTGCTGCCCAGTCCGGCTCACGCCTTCCGCGCGCTCTGCACTGCCGAAGGGGAGCCGCCGCCCGCCCTCGCCTGGTCCGGCCCGGCCCTGGGCAACAGCTTGGCAGCCGTGCGGAGCCCGCGTGAGGGTCACGGCCACCTAGTGACCGCCGAACTGCCCGCACTGACCCATGACGGCCGCTACACGTGTACGGCCGCCAACAGCCTGGGCCGCTCCGAGGCCAGCGTCTACCTGTTCCGCTTCCATGGCGCCAGCGGGGCCTCGACGGTCGCCCTCCTGCTCGGCGCTCTCGGCTTCAAGGCGCTGCTGCTGCTCGGGGTCCTGGCCGCCCGCGCTGCCCGCCGCCGCCCAGAGCATCTGGACACCCCGGACACCCCACCACGGTCCCAGGCCCAGGAGTCCAATTATGAAAATTTGAGCCAGATGAACCCCCGGAGCCCACCAGCCACCATGTGCTCACCGTGA
ORF Protein Sequence MEKSIWLLACLAWVLPTGSFVRTKIDTTENLLNTEVHSSPAQRWSMQVPPEVSAEAGDAAVLPCTFTHPHRHYDGPLTAIWRAGEPYAGPQVFRCAAARGSELCQTALSLHGRFRLLGNPRRNDLSLRVERLALADDRRYFCRVEFAGDVHDRYESRHGVRLHVTAAPRIVNISVLPSPAHAFRALCTAEGEPPPALAWSGPALGNSLAAVRSPREGHGHLVTAELPALTHDGRYTCTAANSLGRSEASVYLFRFHGASGASTVALLLGALGFKALLLLGVLAARAARRRPEHLDTPDTPPRSQAQESNYENLSQMNPRSPPATMCSP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T85507-Ab Anti-SIG15/ SIGLEC15/ CD33L3 monoclonal antibody
    Target Antigen GM-Tg-g-T85507-Ag SIGLEC15 VLP (virus-like particle)
    ORF Viral Vector pGMLP004687 Human SIGLEC15 Lentivirus plasmid
    ORF Viral Vector vGMLP004687 Human SIGLEC15 Lentivirus particle


    Target information

    Target ID GM-T85507
    Target Name Siglec-15/SIGLEC15
    Gene Group Identifier
    (Target Gene ID in Homo species)
    284266
    Gene ID 100068715 (Equus caballus), 100855945 (Canis lupus familiaris), 101084655 (Felis catus), 284266 (Homo sapiens)
    498888 (Rattus norvegicus), 522776 (Bos taurus), 620235 (Mus musculus), 700656 (Macaca mulatta)
    Gene Symbols & Synonyms SIGLEC15,Siglec15,CD33L3,HsT1361,SIGLEC-15,RGD1565948,Cd33l3,EG620235,SIGLEC-I
    Target Alternative Names CD33 antigen-like 3,CD33L3,Cd33l3,EG620235,HsT1361,RGD1565948,SIGLEC-15,SIGLEC-I,SIGLEC15,Sialic acid-binding Ig-like lectin 15,Siglec-15,Siglec15
    Uniprot Accession Q6ZMC9
    Additional SwissProt Accessions: Q6ZMC9
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000018025, ENSCAFG00845003447, ENSG00000197046, ENSBTAG00000016620, ENSMUSG00000091055, ENSMMUG00000003561
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.