Human Cox7a2/COX7AL/COX7AL1 ORF/cDNA clone-Lentivirus plasmid (NM_001865)

Cat. No.: pGMLP004685
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human Cox7a2/COX7AL/COX7AL1 Lentiviral expression plasmid for Cox7a2 lentivirus packaging, Cox7a2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to COX7A2/Cox7a2/COX7AL products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004685
Gene Name Cox7a2
Accession Number NM_001865
Gene ID 1347
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 348 bp
Gene Alias COX7AL,COX7AL1,COXVIIa-L,COXVIIAL,VIIAL
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGCGGAATCTGCTGGCTCTTCGTCAGATTGGGCAGAGGACGATAAGCACTGCTTCCCGCAGGCATTTTAAAAATAAAGTTCCGGAGAAGCAAAAACTGTTCCAGGAGGATGATGAAATTCCACTGTATCTAAAGGGTGGGGTAGCTGATGCCCTCCTGTATAGAGCCACCATGATTCTTACAGTTGGTGGAACAGCATATGCCATATATGAGCTGGCTGTGGCTTCATTTCCCAAGAAGCAGGAGTGA
ORF Protein Sequence MLRNLLALRQIGQRTISTASRRHFKNKVPEKQKLFQEDDEIPLYLKGGVADALLYRATMILTVGGTAYAIYELAVASFPKKQE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0604-Ab Anti-COX7A2 monoclonal antibody
    Target Antigen GM-Tg-g-IP0604-Ag COX7A2 protein
    ORF Viral Vector pGMLP004685 Human Cox7a2 Lentivirus plasmid
    ORF Viral Vector vGMLP004685 Human Cox7a2 Lentivirus particle


    Target information

    Target ID GM-IP0604
    Target Name COX7A2
    Gene Group Identifier
    (Target Gene ID in Homo species)
    1347
    Gene ID 100630209 (Equus caballus), 101093608 (Felis catus), 119863903 (Canis lupus familiaris), 12866 (Mus musculus)
    1347 (Homo sapiens), 29507 (Rattus norvegicus), 327688 (Bos taurus), 717879 (Macaca mulatta)
    Gene Symbols & Synonyms COX7A2,LOC119863903,Cox7a2,LOC717879,COX7AL,Cox7a3,CoxVIIa-L,VIIAL,COX7AL1,COXVIIAL,COXVIIa-L
    Target Alternative Names COX7A2,COX7AL,COX7AL1,COXVIIAL,COXVIIa-L,Cox7a2,Cox7a3,CoxVIIa-L,Cytochrome c oxidase subunit 7A2,Cytochrome c oxidase subunit VIIa-liver/heart (Cytochrome c oxidase subunit VIIa-L,Cytochrome c oxidase subunit VIIaL),LOC119863903,LOC717879,VIIAL,mitochondrial
    Uniprot Accession P13184,P14406,P35171,P48771
    Additional SwissProt Accessions: P48771,P14406,P35171,P13184
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG Metabolic pathways, Alzheimer disease
    Gene Ensembl ENSMUSG00000032330, ENSG00000112695, ENSBTAG00000005096, ENSMMUG00000043152
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.