Human BST2/CD317/TETHERIN ORF/cDNA clone-Lentivirus plasmid (NM_004335)

Cat. No.: pGMLP004620
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human BST2/CD317/TETHERIN Lentiviral expression plasmid for BST2 lentivirus packaging, BST2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to BST2/CD317/BST2/CD317 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $435.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004620
Gene Name BST2
Accession Number NM_004335
Gene ID 684
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 543 bp
Gene Alias CD317,TETHERIN
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCATCTACTTCGTATGACTATTGCAGAGTGCCCATGGAAGACGGGGATAAGCGCTGTAAGCTTCTGCTGGGGATAGGAATTCTGGTGCTCCTGATCATCGTGATTCTGGGGGTGCCCTTGATTATCTTCACCATCAAGGCCAACAGCGAGGCCTGCCGGGACGGCCTTCGGGCAGTGATGGAGTGTCGCAATGTCACCCATCTCCTGCAACAAGAGCTGACCGAGGCCCAGAAGGGCTTTCAGGATGTGGAGGCCCAGGCCGCCACCTGCAACCACACTGTGATGGCCCTAATGGCTTCCCTGGATGCAGAGAAGGCCCAAGGACAAAAGAAAGTGGAGGAGCTTGAGGGAGAGATCACTACATTAAACCATAAGCTTCAGGACGCGTCTGCAGAGGTGGAGCGACTGAGAAGAGAAAACCAGGTCTTAAGCGTGAGAATCGCGGACAAGAAGTACTACCCCAGCTCCCAGGACTCCAGCTCCGCTGCGGCGCCCCAGCTGCTGATTGTGCTGCTGGGCCTCAGCGCTCTGCTGCAGTGA
ORF Protein Sequence MASTSYDYCRVPMEDGDKRCKLLLGIGILVLLIIVILGVPLIIFTIKANSEACRDGLRAVMECRNVTHLLQQELTEAQKGFQDVEAQAATCNHTVMALMASLDAEKAQGQKKVEELEGEITTLNHKLQDASAEVERLRRENQVLSVRIADKKYYPSSQDSSSAAAPQLLIVLLGLSALLQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T77745-Ab Anti-BST2/ CD317/ TETHERIN monoclonal antibody
    Target Antigen GM-Tg-g-T77745-Ag BST2 VLP (virus-like particle)
    ORF Viral Vector pGMLP004620 Human BST2 Lentivirus plasmid
    ORF Viral Vector vGMLP004620 Human BST2 Lentivirus particle


    Target information

    Target ID GM-T77745
    Target Name BST2/CD317
    Gene Group Identifier
    (Target Gene ID in Homo species)
    684
    Gene ID 100146856 (Equus caballus), 100652388 (Felis catus), 378947 (Rattus norvegicus), 609654 (Canis lupus familiaris)
    684 (Homo sapiens), 69550 (Mus musculus), 719092 (Macaca mulatta)
    Gene Symbols & Synonyms BST2,Bst2,Damp1,DAMP-1,CD317,HM1.24,TETHERIN,GREG,Bst-2,2310015I10Rik,BST-2,BST2.1,BST2.3,BST2.4,BST2.5,BST2.6,BST2.7,BST2.9,BST2.10,BST2.11,BST2.12,BST2.13,BST2.14,BST2.15
    Target Alternative Names 2310015I10Rik,BST-2,BST2,BST2.1,BST2.10,BST2.11,BST2.12,BST2.13,BST2.14,BST2.15,BST2.3,BST2.4,BST2.5,BST2.6,BST2.7,BST2.9,Bone marrow stromal antigen 2,Bst-2,Bst2,CD317,DAMP-1,Damp1,GREG,HM1.24,HM1.24 antigen,TETHERIN,Tetherin
    Uniprot Accession Q10589,Q811A2,Q8R2Q8
    Additional SwissProt Accessions: Q811A2,Q10589,Q8R2Q8
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000003563, ENSCAFG00845027704, ENSG00000130303, ENSMUSG00000046718, ENSMMUG00000005829
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.