Human Gkn2/BRICD1B/GDDR ORF/cDNA clone-Lentivirus plasmid (NM_182536)

Cat. No.: pGMLP004593
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human Gkn2/BRICD1B/GDDR Lentiviral expression plasmid for Gkn2 lentivirus packaging, Gkn2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to GKN2/Gkn2/BRICD1B products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $438.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004593
Gene Name Gkn2
Accession Number NM_182536
Gene ID 200504
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 555 bp
Gene Alias BRICD1B,GDDR,PRO813,TFIZ1,VLTI465
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAAATACTTGTGGCATTTCTGGTGGTGCTGACCATCTTTGGGATACAATCTCATGGATACGAGGTTTTTAACATCATCAGCCCAAGCAACAATGGTGGCAATGTTCAGGAGACAGTGACAATTGATAATGAAAAAAATACCGCCATCATTAACATCCATGCAGGATCATGCTCTTCTACCACAATTTTTGACTATAAACATGGCTACATTGCATCCAGGGTGCTCTCCCGAAGAGCCTGCTTTATCCTGAAGATGGACCATCAGAACATCCCTCCTCTGAACAATCTCCAATGGTACATCTATGAGAAACAGGCTCTGGACAACATGTTCTCCAGCAAATACACCTGGGTCAAGTACAACCCTCTGGAGTCTCTGATCAAAGACGTGGATTGGTTCCTGCTTGGGTCACCCATTGAGAAACTCTGCAAACATATCCCTTTGTATAAGGGGGAAGTGGTTGAAAACACACATAATGTCGGTGCTGGAGGCTGTGCAAAGGCTGGGCTCCTGGGCATCTTGGGAATTTCAATCTGTGCAGACATTCATGTTTAG
ORF Protein Sequence MKILVAFLVVLTIFGIQSHGYEVFNIISPSNNGGNVQETVTIDNEKNTAIINIHAGSCSSTTIFDYKHGYIASRVLSRRACFILKMDHQNIPPLNNLQWYIYEKQALDNMFSSKYTWVKYNPLESLIKDVDWFLLGSPIEKLCKHIPLYKGEVVENTHNVGAGGCAKAGLLGILGISICADIHV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0947-Ab Anti-GKN2/ BRICD1B/ GDDR functional antibody
    Target Antigen GM-Tg-g-SE0947-Ag GKN2 protein
    ORF Viral Vector pGMLP004593 Human Gkn2 Lentivirus plasmid
    ORF Viral Vector vGMLP004593 Human Gkn2 Lentivirus particle


    Target information

    Target ID GM-SE0947
    Target Name GKN2
    Gene Group Identifier
    (Target Gene ID in Homo species)
    200504
    Gene ID 100061407 (Equus caballus), 101093178 (Felis catus), 200504 (Homo sapiens), 297419 (Rattus norvegicus)
    512001 (Bos taurus), 612594 (Canis lupus familiaris), 66284 (Mus musculus), 700323 (Macaca mulatta)
    Gene Symbols & Synonyms GKN2,Gkn2,GDDR,TFIZ1,PRO813,BRICD1B,VLTI465,RGD1311934,Bricd1b,1810036H07Rik
    Target Alternative Names GKN2,Gastrokine-2,Blottin, Down-regulated in gastric cancer, Trefoil factor interactions(z) 1,GDDR,TFIZ1,PRO813,BRICD1B,VLTI465
    Uniprot Accession Q29TV8,Q86XP6,Q9CQS6
    Additional SwissProt Accessions: Q86XP6,Q29TV8,Q9CQS6
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000024120, ENSG00000183607, ENSBTAG00000017199, ENSCAFG00845023893, ENSMUSG00000030049
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.