Human ASCL1/ASH1/bHLHa46 ORF/cDNA clone-Lentivirus plasmid (NM_004316)

Cat. No.: pGMLP004565
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ASCL1/ASH1/bHLHa46 Lentiviral expression plasmid for ASCL1 lentivirus packaging, ASCL1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to ASCL1/ASH1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $477.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004565
Gene Name ASCL1
Accession Number NM_004316
Gene ID 429
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 711 bp
Gene Alias ASH1,bHLHa46,HASH1,MASH1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAAAGCTCTGCCAAGATGGAGAGCGGCGGCGCCGGCCAGCAGCCCCAGCCGCAGCCCCAGCAGCCCTTCCTGCCGCCCGCAGCCTGTTTCTTTGCCACGGCCGCAGCCGCGGCGGCCGCAGCCGCCGCAGCGGCAGCGCAGAGCGCGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGGCGCCGCAGCTGAGACCGGCGGCCGACGGCCAGCCCTCAGGGGGCGGTCACAAGTCAGCGCCCAAGCAAGTCAAGCGACAGCGCTCGTCTTCGCCCGAACTGATGCGCTGCAAACGCCGGCTCAACTTCAGCGGCTTTGGCTACAGCCTGCCGCAGCAGCAGCCGGCCGCCGTGGCGCGCCGCAACGAGCGCGAGCGCAACCGCGTCAAGTTGGTCAACCTGGGCTTTGCCACCCTTCGGGAGCACGTCCCCAACGGCGCGGCCAACAAGAAGATGAGTAAGGTGGAGACACTGCGCTCGGCGGTCGAGTACATCCGCGCGCTGCAGCAGCTGCTGGACGAGCATGACGCGGTGAGCGCCGCCTTCCAGGCAGGCGTCCTGTCGCCCACCATCTCCCCCAACTACTCCAACGACTTGAACTCCATGGCCGGCTCGCCGGTCTCATCCTACTCGTCGGACGAGGGCTCTTACGACCCGCTCAGCCCCGAGGAGCAGGAGCTTCTCGACTTCACCAACTGGTTCTGA
ORF Protein Sequence MESSAKMESGGAGQQPQPQPQQPFLPPAACFFATAAAAAAAAAAAAAQSAQQQQQQQQQQQQAPQLRPAADGQPSGGGHKSAPKQVKRQRSSSPELMRCKRRLNFSGFGYSLPQQQPAAVARRNERERNRVKLVNLGFATLREHVPNGAANKKMSKVETLRSAVEYIRALQQLLDEHDAVSAAFQAGVLSPTISPNYSNDLNSMAGSPVSSYSSDEGSYDPLSPEEQELLDFTNWF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1510-Ab Anti-ASCL1/ ASH1/ HASH1 functional antibody
    Target Antigen GM-Tg-g-SE1510-Ag ASCL1 protein
    ORF Viral Vector pGMLP004565 Human ASCL1 Lentivirus plasmid
    ORF Viral Vector vGMLP004565 Human ASCL1 Lentivirus particle


    Target information

    Target ID GM-SE1510
    Target Name ASCL1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    429
    Gene ID 100146286 (Equus caballus), 101081993 (Felis catus), 17172 (Mus musculus), 429 (Homo sapiens)
    482628 (Canis lupus familiaris), 540473 (Bos taurus), 64186 (Rattus norvegicus), 698820 (Macaca mulatta)
    Gene Symbols & Synonyms ASCL1,Ascl1,ASH1,Mash1,bHLHa46,HASH1,MASH1
    Target Alternative Names ASCL1,ASH-1,ASH1,Achaete-scute homolog 1,Ascl1,Class A basic helix-loop-helix protein 46 (bHLHa46),HASH1,MASH1,Mash1,bHLHa46,hASH1
    Uniprot Accession P19359,P50553,Q02067
    Additional SwissProt Accessions: Q02067,P50553,P19359
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category
    Disease cancer
    Disease from KEGG
    Gene Ensembl ENSMUSG00000020052, ENSG00000139352, ENSBTAG00000052521, ENSMMUG00000005747
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.