Human VSIR/B7-H5/B7H5 ORF/cDNA clone-Lentivirus plasmid (NM_022153)

Cat. No.: pGMLP004294
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human VSIR/B7-H5/B7H5 Lentiviral expression plasmid for VSIR lentivirus packaging, VSIR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to VISTA/VSIR/VSIR/B7-H5 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $534
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004294
Gene Name VSIR
Accession Number NM_022153
Gene ID 64115
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 936 bp
Gene Alias B7-H5,B7H5,C10orf54,DD1alpha,GI24,PD-1H,PP2135,SISP1,VISTA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGCGTCCCCACGGCCCTGGAGGCCGGCAGCTGGCGCTGGGGATCCCTGCTCTTCGCTCTCTTCCTGGCTGCGTCCCTAGGTCCGGTGGCAGCCTTCAAGGTCGCCACGCCGTATTCCCTGTATGTCTGTCCCGAGGGGCAGAACGTCACCCTCACCTGCAGGCTCTTGGGCCCTGTGGACAAAGGGCACGATGTGACCTTCTACAAGACGTGGTACCGCAGCTCGAGGGGCGAGGTGCAGACCTGCTCAGAGCGCCGGCCCATCCGCAACCTCACGTTCCAGGACCTTCACCTGCACCATGGAGGCCACCAGGCTGCCAACACCAGCCACGACCTGGCTCAGCGCCACGGGCTGGAGTCGGCCTCCGACCACCATGGCAACTTCTCCATCACCATGCGCAACCTGACCCTGCTGGATAGCGGCCTCTACTGCTGCCTGGTGGTGGAGATCAGGCACCACCACTCGGAGCACAGGGTCCATGGTGCCATGGAGCTGCAGGTGCAGACAGGCAAAGATGCACCATCCAACTGTGTGGTGTACCCATCCTCCTCCCAGGATAGTGAAAACATCACGGCTGCAGCCCTGGCTACGGGTGCCTGCATCGTAGGAATCCTCTGCCTCCCCCTCATCCTGCTCCTGGTCTACAAGCAAAGGCAGGCAGCCTCCAACCGCCGTGCCCAGGAGCTGGTGCGGATGGACAGCAACATTCAAGGGATTGAAAACCCCGGCTTTGAAGCCTCACCACCTGCCCAGGGGATACCCGAGGCCAAAGTCAGGCACCCCCTGTCCTATGTGGCCCAGCGGCAGCCTTCTGAGTCTGGGCGGCATCTGCTTTCGGAGCCCAGCACCCCCCTGTCTCCTCCAGGCCCCGGAGACGTCTTCTTCCCATCCCTGGACCCTGTCCCTGACTCTCCAAACTTTGAGGTCATCTAG
ORF Protein Sequence MGVPTALEAGSWRWGSLLFALFLAASLGPVAAFKVATPYSLYVCPEGQNVTLTCRLLGPVDKGHDVTFYKTWYRSSRGEVQTCSERRPIRNLTFQDLHLHHGGHQAANTSHDLAQRHGLESASDHHGNFSITMRNLTLLDSGLYCCLVVEIRHHHSEHRVHGAMELQVQTGKDAPSNCVVYPSSSQDSENITAAALATGACIVGILCLPLILLLVYKQRQAASNRRAQELVRMDSNIQGIENPGFEASPPAQGIPEAKVRHPLSYVAQRQPSESGRHLLSEPSTPLSPPGPGDVFFPSLDPVPDSPNFEVI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-ab-406 Pre-Made Onvatilimab biosimilar, Whole mAb, Anti-VSIR Antibody: Anti-B7-H5/B7H5/C10orf54/DD1alpha/Dies1/GI24/PD-1H/PP2135/SISP1/VISTA therapeutic antibody
    Target Antibody GM-Tg-g-T99704-Ab Anti-VISTA/ VSIR/ B7-H5 monoclonal antibody
    Target Antigen GM-Tg-g-T99704-Ag VSIR VLP (virus-like particle)
    ORF Viral Vector pGMLP004294 Human VSIR Lentivirus plasmid
    ORF Viral Vector pGMLV000879 Human VSIR Lentivirus plasmid
    ORF Viral Vector pGMLV000880 Human VSIR Lentivirus plasmid
    ORF Viral Vector vGMLP004294 Human VSIR Lentivirus particle
    ORF Viral Vector vGMLV000879 Human VSIR Lentivirus particle
    ORF Viral Vector vGMLV000880 Human VSIR Lentivirus particle


    Target information

    Target ID GM-T99704
    Target Name VISTA/VSIR
    Gene Group Identifier
    （Target Gene ID in Homo species)         		64115
    Gene ID 101096355 (Felis catus), 102149832 (Equus caballus), 106558705 (Canis lupus familiaris), 64115 (Homo sapiens)
    690899 (Rattus norvegicus), 709595 (Macaca mulatta), 74048 (Mus musculus), 783068 (Bos taurus)
    Gene Symbols & Synonyms VSIR,Vsir,CD2H10orf54,C1H10orf54,C4H10orf54,B7H5,GI24,B7-H5,Dies1,PD-1H,SISP1,VISTA,PP2135,C10orf54,DD1alpha,C9orf54,C9H10orf54,4632428N05Rik,C28H10orf54
    Target Alternative Names VISTA, VSIR,V-type immunoglobulin domain-containing suppressor of T-cell activation,Platelet receptor Gi24, Stress-induced secreted protein-1 (Sisp-1), V-set domain-containing immunoregulatory receptor, V-set immunoregulatory receptor,B7H5,GI24,B7-H5,Dies1,PD-1H,SISP1,VISTA,PP2135,C10orf54,DD1alpha
    Uniprot Accession Q9D659,Q9H7M9
    Additional SwissProt Accessions: Q9H7M9,Q9D659
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, INN Index
    Disease
    Disease from KEGG Cell adhesion molecules
    Gene Ensembl ENSECAG00000018133, ENSCAFG00845004580, ENSG00000107738, ENSMMUG00000012967, ENSMUSG00000020101, ENSBTAG00000010888
    Target Classification Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.