Human SLC10A2/ASBT/IBAT ORF/cDNA clone-Lentivirus plasmid (NM_000452)

Cat. No.: pGMLP004274
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SLC10A2/ASBT/IBAT Lentiviral expression plasmid for SLC10A2 lentivirus packaging, SLC10A2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to ASBT/SLC10A2/SLC10A2/ASBT products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $593.16
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004274
Gene Name SLC10A2
Accession Number NM_000452
Gene ID 6555
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1047 bp
Gene Alias ASBT,IBAT,ISBT,NTCP2,PBAM
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAATGATCCGAACAGCTGTGTGGACAATGCAACAGTTTGCTCTGGTGCATCCTGTGTGGTACCTGAGAGCAATTTCAATAACATCCTAAGTGTGGTCCTAAGTACGGTGCTGACCATCCTGTTGGCCTTGGTGATGTTCTCCATGGGATGCAACGTGGAAATCAAGAAATTTCTAGGGCACATAAAGCGGCCGTGGGGCATTTGTGTTGGCTTCCTCTGTCAGTTTGGAATCATGCCCCTCACAGGATTCATCCTGTCGGTGGCCTTTGACATCCTCCCGCTCCAGGCCGTAGTGGTGCTCATTATAGGATGCTGCCCTGGAGGAACTGCCTCCAATATCTTGGCCTATTGGGTCGATGGCGACATGGACCTGAGCGTCAGCATGACCACATGCTCCACACTGCTTGCCCTCGGAATGATGCCGCTGTGCCTCCTTATCTATACCAAAATGTGGGTCGACTCTGGGAGCATCGTAATTCCCTATGATAACATAGGTACATCTCTGGTTTCTCTCGTTGTTCCTGTTTCCATTGGAATGTTTGTTAATCACAAATGGCCCCAAAAAGCAAAGATCATACTTAAAATTGGGTCCATCGCGGGCGCCATCCTCATTGTGCTCATAGCTGTGGTTGGAGGAATATTGTACCAAAGCGCCTGGATCATTGCTCCCAAACTGTGGATTATAGGAACAATATTTCCTGTGGCGGGTTACTCCCTGGGGTTTCTTCTGGCTAGAATTGCTGGTCTACCCTGGTACAGGTGCCGAACGGTTGCTTTTGAAACGGGGATGCAGAACACGCAGCTATGTTCCACCATCGTTCAGCTCTCCTTCACTCCTGAGGAGCTCAATGTCGTATTCACCTTCCCGCTCATCTACAGCATTTTCCAGCTCGCCTTTGCCGCAATATTCTTAGGATTTTATGTGGCATACAAGAAATGTCATGGAAAAAACAAGGCAGAAATTCCAGAGAGCAAAGAAAATGGAACGGAGCCAGAGTCATCGTTTTATAAGGCAAATGGAGGATTTCAACCTGACGAAAAGTAG
ORF Protein Sequence MNDPNSCVDNATVCSGASCVVPESNFNNILSVVLSTVLTILLALVMFSMGCNVEIKKFLGHIKRPWGICVGFLCQFGIMPLTGFILSVAFDILPLQAVVVLIIGCCPGGTASNILAYWVDGDMDLSVSMTTCSTLLALGMMPLCLLIYTKMWVDSGSIVIPYDNIGTSLVSLVVPVSIGMFVNHKWPQKAKIILKIGSIAGAILIVLIAVVGGILYQSAWIIAPKLWIIGTIFPVAGYSLGFLLARIAGLPWYRCRTVAFETGMQNTQLCSTIVQLSFTPEELNVVFTFPLIYSIFQLAFAAIFLGFYVAYKKCHGKNKAEIPESKENGTEPESSFYKANGGFQPDEK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T24982-Ab Anti-NTCP2/ SLC10A2/ ASBT monoclonal antibody
    Target Antigen GM-Tg-g-T24982-Ag SLC10A2 VLP (virus-like particle)
    ORF Viral Vector pGMLP004274 Human SLC10A2 Lentivirus plasmid
    ORF Viral Vector vGMLP004274 Human SLC10A2 Lentivirus particle


    Target information

    Target ID GM-T24982
    Target Name ASBT/SLC10A2
    Gene Group Identifier
    (Target Gene ID in Homo species)
    6555
    Gene ID 100051264 (Equus caballus), 101083393 (Felis catus), 20494 (Mus musculus), 29500 (Rattus norvegicus)
    403448 (Canis lupus familiaris), 525823 (Bos taurus), 6555 (Homo sapiens), 702376 (Macaca mulatta)
    Gene Symbols & Synonyms SLC10A2,Slc10a2,ASBT,IBAT,ISBT,9130221J18Rik,ISBAT,PBAM,NTCP2,PBAM1
    Target Alternative Names 9130221J18Rik,ASBT,Apical sodium-dependent bile acid transporter (ASBT),IBAT,ISBAT,ISBT,ISBT),Ileal Na(+)/bile acid cotransporter,Ileal sodium-dependent bile acid transporter (IBAT,Ileal sodium/bile acid cotransporter,NTCP2,Na(+)-dependent ileal bile acid transporter,PBAM,PBAM1,SLC10A2,Slc10a2,Sodium/taurocholate cotransporting polypeptide,Solute carrier family 10 member 2,ileal
    Uniprot Accession P70172,Q12908,Q62633
    Additional SwissProt Accessions: P70172,Q62633,Q12908
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG Bile secretion
    Gene Ensembl ENSECAG00000006314, ENSMUSG00000023073, ENSCAFG00845027780, ENSBTAG00000005925, ENSG00000125255, ENSMMUG00000007664
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.