Human FAIM/FAIM1 ORF/cDNA clone-Lentivirus plasmid (NM_001033030)

Cat. No.: pGMLP004184
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FAIM/FAIM1 Lentiviral expression plasmid for FAIM lentivirus packaging, FAIM lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to FAIM/FAIM1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $460.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004184
Gene Name FAIM
Accession Number NM_001033030
Gene ID 55179
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 642 bp
Gene Alias FAIM1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCTGCTTCCCTTTATAAGGACACTCCCACTGTTGTGCTATAATCATCTCTTGGTATCTCCGGACTCTGCCACTCTGAGCCCTCCTTACAGCCTAGAAAAAATGACAGATCTCGTAGCTGTTTGGGATGTTGCTTTAAGTGACGGAGTCCACAAGATCGAATTTGAACATGGGACTACATCAGGCAAACGAGTAGTATATGTAGATGGAAAGGAAGAGATAAGAAAAGAGTGGATGTTCAAATTAGTGGGCAAAGAAACATTCTATGTTGGAGCTGCAAAGACAAAAGCGACCATAAATATAGACGCTATCAGTGGTTTTGCTTATGAATATACTCTGGAAATTAATGGGAAAAGTCTCAAGAAGTATATGGAGGACAGATCAAAAACCACCAATACTTGGGTATTACACATGGATGGTGAGAACTTTAGAATTGTTTTGGAAAAAGATGCTATGGACGTATGGTGCAATGGTAAAAAATTGGAGACAGCGGGTGAGTTTGTAGATGATGGGACTGAAACTCACTTCAGTATCGGGAACCATGACTGTTACATAAAGGCTGTCAGTAGTGGGAAGCGGAAAGAAGGGATTATTCATACTCTCATTGTGGATAATAGAGAAATCCCAGAGATTGCAAGTTAA
ORF Protein Sequence MLLPFIRTLPLLCYNHLLVSPDSATLSPPYSLEKMTDLVAVWDVALSDGVHKIEFEHGTTSGKRVVYVDGKEEIRKEWMFKLVGKETFYVGAAKTKATINIDAISGFAYEYTLEINGKSLKKYMEDRSKTTNTWVLHMDGENFRIVLEKDAMDVWCNGKKLETAGEFVDDGTETHFSIGNHDCYIKAVSSGKRKEGIIHTLIVDNREIPEIAS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2484-Ab Anti-FAIM monoclonal antibody
    Target Antigen GM-Tg-g-IP2484-Ag FAIM protein
    ORF Viral Vector pGMLP004184 Human FAIM Lentivirus plasmid
    ORF Viral Vector vGMLP004184 Human FAIM Lentivirus particle


    Target information

    Target ID GM-IP2484
    Target Name FAIM
    Gene Group Identifier
    (Target Gene ID in Homo species)
    55179
    Gene ID 100051813 (Equus caballus), 101092137 (Felis catus), 485687 (Canis lupus familiaris), 55179 (Homo sapiens)
    616795 (Bos taurus), 716216 (Macaca mulatta)
    Gene Symbols & Synonyms FAIM,FAIM1
    Target Alternative Names FAIM,Fas apoptotic inhibitory molecule 1,FAIM1
    Uniprot Accession Q0IIF6,Q9NVQ4
    Additional SwissProt Accessions: Q9NVQ4,Q0IIF6
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000023744, ENSCAFG00845025733, ENSG00000158234, ENSBTAG00000023426, ENSMMUG00000008664
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.