Human AKR1B10/AKR1B12/ALDRLn ORF/cDNA clone-Lentivirus plasmid (BC008837)

Cat. No.: pGMLP004050
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human AKR1B10/AKR1B12/ALDRLn Lentiviral expression plasmid for AKR1B10 lentivirus packaging, AKR1B10 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to AKR1B10/AKR1B12 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $537.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004050
Gene Name AKR1B10
Accession Number BC008837
Gene ID 57016
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 951 bp
Gene Alias AKR1B12,ALDRLn,ARL-1,ARL1,HIS,HSI,MGC14103
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCACGTTTGTGGAGCTCAGTACCAAAGCCAAGATGCCCATTGTGGGCCTGGGCACTTGGAAGTCTCCTCTTGGCAAAGTGAAAGAAGCAGTGAAGGTGGCCATTGATGCAGGATATCGGCACATTGACTGTGCCTATGTCTATCAGAATGAACATGAAGTGGGGGAAGCCATCCAAGAGAAGATCCAAGAGAAGGCTGTGAAGCGGGAGGACCTGTTCATCGTCAGCAAGTTGTGGCCCACTTTCTTTGAGAGACCCCTTGTGAGGAAAGCCTTTGAGAAGACCCTCAAGGACCTGAAGCTGAGCTATCTGGACGTCTATCTTATTCACTGGCCACAGGGATTCAAGTCTGGGGATGACCTTTTCCCCAAAGATGATAAAGGTAATGCCATCGGTGGAAAAGCAACGTTCTTGGATGCCTGGGAGGCCATGGAGGAGCTGGTGGATGAGGGGCTGGTGAAAGCCCTTGGGGTCTCCAATTTCAGCCACTTCCAGATCGAGAAGCTCTTGAACAAACCTGGACTGAAATATAAACCAGTGACTAACCAGGTTGAGTGTCACCCATACCTCACACAGGAGAAACTGATCCAGTACTGCCACTCCAAGGGCATCACCGTTACGGCCTACAGCCCCCTGGGCTCTCCGGATAGACCTTGGGCCAAGCCAGAAGACCCTTCCCTGCTGGAGGATCCCAAGATTAAGGAGATTGCTGCAAAGCACAAAAAAACCGCAGCCCAGGTTCTGATCCGTTTCCATATCCAGAGGAATGTGATTGTCATCCCCAAGTCTGTGACACCAGCACGCATTGTTGAGAACATTCAGGTCTTTGACTTTAAATTGAGTGATGAGGAGATGGCAACCATACTCAGCTTCAACAGAAACTGGAGGGCCTGTAACGTGTTGCAATCCTCTCATTTGGAAGACTATCCCTTCGATGCAGAATATTGA
ORF Protein Sequence MATFVELSTKAKMPIVGLGTWKSPLGKVKEAVKVAIDAGYRHIDCAYVYQNEHEVGEAIQEKIQEKAVKREDLFIVSKLWPTFFERPLVRKAFEKTLKDLKLSYLDVYLIHWPQGFKSGDDLFPKDDKGNAIGGKATFLDAWEAMEELVDEGLVKALGVSNFSHFQIEKLLNKPGLKYKPVTNQVECHPYLTQEKLIQYCHSKGITVTAYSPLGSPDRPWAKPEDPSLLEDPKIKEIAAKHKKTAAQVLIRFHIQRNVIVIPKSVTPARIVENIQVFDFKLSDEEMATILSFNRNWRACNVLQSSHLEDYPFDAEY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0571-Ab Anti-AK1BA/ AKR1B10/ AKR1B11 functional antibody
    Target Antigen GM-Tg-g-SE0571-Ag AKR1B10 protein
    ORF Viral Vector pGMLP004050 Human AKR1B10 Lentivirus plasmid
    ORF Viral Vector pGMLV000888 Human AKR1B10 Lentivirus plasmid
    ORF Viral Vector vGMLP004050 Human AKR1B10 Lentivirus particle
    ORF Viral Vector vGMLV000888 Human AKR1B10 Lentivirus particle


    Target information

    Target ID GM-SE0571
    Target Name AKR1B10
    Gene Group Identifier
    (Target Gene ID in Homo species)
    57016
    Gene ID 525193 (Bos taurus), 57016 (Homo sapiens)
    Gene Symbols & Synonyms AKR1B10,HIS,HSI,ARL1,ARL-1,ALDRLn,AKR1B11,AKR1B12
    Target Alternative Names AKR1B10,AKR1B11,AKR1B12,ALDRLn,ARL-1,ARL1,Aldo-keto reductase family 1 member B10,Aldose reductase-like,Aldose reductase-related protein (ARP,HIS,HSI,Small intestine reductase (SI reductase),hARP)
    Uniprot Accession O60218
    Additional SwissProt Accessions: O60218
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category
    Disease cancer
    Disease from KEGG Metabolic pathways, Pentose and glucuronate interconversions
    Gene Ensembl ENSBTAG00000001582, ENSG00000198074
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.