Human ZD52F10/UNQ729 ORF/cDNA clone-Lentivirus plasmid (BC011886)

Cat. No.: pGMLP004013
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ZD52F10/UNQ729 Lentiviral expression plasmid for ZD52F10 lentivirus packaging, ZD52F10 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to DMKN/ZD52F10/UNQ729 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP004013
Gene Name ZD52F10
Accession Number BC011886
Gene ID 93099
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 414 bp
Gene Alias UNQ729
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTTTAACTTTGACACTTTCTGGAAGAATTTTAAATCCAAGCTGGGTTTCATCAACTGGGATGCCATAAACAAGAACCAGGTCCCGCCCCCCAGCACCCGAGCCCTCCTCTACTTCAGCCGACTCTGGGAGGATTTCAAACAGAACACTCCTTTCCTCAACTGGAAAGCAATTATTGAGGGTGCGGACGCGTCATCACTGCAGAAACGTGCAGGCAGAGCCGATCAGCCGGGTGCAGGATGGCAGGAGGTGGCAGCTGTAACTTCCAAGAACTACAATTACAACCAGCATGCGTATCCCACTGCCTATGGTGGGAAGTACTCAGTCAAGACCCCTGCAAAGGGGGGAGTCTCACCTTCTTCCTCGGCTTCCCGGGTGCAACCTGGCCTGCTGCAGTGGGTGAAGTTTTGGTAG
ORF Protein Sequence MFNFDTFWKNFKSKLGFINWDAINKNQVPPPSTRALLYFSRLWEDFKQNTPFLNWKAIIEGADASSLQKRAGRADQPGAGWQEVAAVTSKNYNYNQHAYPTAYGGKYSVKTPAKGGVSPSSSASRVQPGLLQWVKFW

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0890-Ab Anti-DMKN/ UNQ729/ ZD52F10 functional antibody
    Target Antigen GM-Tg-g-SE0890-Ag DMKN protein
    ORF Viral Vector pGMLP004013 Human ZD52F10 Lentivirus plasmid
    ORF Viral Vector vGMLP004013 Human ZD52F10 Lentivirus particle


    Target information

    Target ID GM-SE0890
    Target Name DMKN
    Gene Group Identifier
    (Target Gene ID in Homo species)
    93099
    Gene ID 101100017 (Felis catus), 102150590 (Equus caballus), 361548 (Rattus norvegicus), 476484 (Canis lupus familiaris)
    618159 (Bos taurus), 718709 (Macaca mulatta), 73712 (Mus musculus), 93099 (Homo sapiens)
    Gene Symbols & Synonyms DMKN,Dmkn,RGD1561521,SK30,SK89,cI-36,C130074A08,1110014F24Rik,UNQ729,ZD52F10
    Target Alternative Names DMKN,Dermokine,Epidermis-specific secreted protein SK30/SK89,UNQ729,ZD52F10
    Uniprot Accession A2VE23,Q6E0U4,Q6P253
    Additional SwissProt Accessions: A2VE23,Q6P253,Q6E0U4
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000025084, ENSCAFG00845002671, ENSBTAG00000015912, ENSMMUG00000058405, ENSMUSG00000060962, ENSG00000161249
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.