Human PRNP/ASCR/CD230 ORF/cDNA clone-Lentivirus plasmid (BC022532.1)

Cat. No.: pGMLP003874
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human PRNP/ASCR/CD230 Lentiviral expression plasmid for PRNP lentivirus packaging, PRNP lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to PrP/PRNP/PRNP/ASCR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $490.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003874
Gene Name PRNP
Accession Number BC022532.1
Gene ID 5621
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 762 bp
Gene Alias ASCR,CD230,prion,PrP,PrP27-30,PrP33-35C,PrPc
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGAACCTTGGCTGCTGGATGCTGGTTCTCTTTGTGGCCACATGGAGTGACCTGGGCCTCTGCAAGAAGCGCCCGAAGCCTGGAGGATGGAACACTGGGGGCAGCCGATACCCGGGGCAGGGCAGCCCTGGAGGCAACCGCTACCCACCTCAGGGCGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCTCATGGTGGTGGCTGGGGGCAGCCCCATGGTGGTGGCTGGGGACAGCCTCATGGTGGTGGCTGGGGTCAAGGAGGTGGCACCCACAGTCAGTGGAACAAGCCGAGTAAGCCAAAAACCAACATGAAGCACATGGCTGGTGCTGCAGCAGCTGGGGCAGTGGTGGGGGGCCTTGGCGGCTACGTGCTGGGAAGTGCCATGAGCAGGCCCATCATACATTTCGGCAGTGACTATGAGGACCGTTACTATCGTGAAAACATGCACCGTTACCCCAACCAAGTGTACTACAGGCCCATGGATGAGTACAGCAACCAGAACAACTTTGTGCACGACTGCGTCAATATCACAATCAAGCAGCACACGGTCACCACAACCACCAAGGGGGAGAACTTCACCGAGACCGACGTTAAGATGATGGAGCGCGTGGTTGAGCAGATGTGTATCACCCAGTACGAGAGGGAATCTCAGGCCTATTACAAGAGAGGATCGAGCATGGTCCTCTTCTCCTCTCCACCTGTGATCCTCCTGATCTCTTTCCTCATCTTCCTGATAGTGGGATGA
ORF Protein Sequence MANLGCWMLVLFVATWSDLGLCKKRPKPGGWNTGGSRYPGQGSPGGNRYPPQGGGGWGQPHGGGWGQPHGGGWGQPHGGGWGQPHGGGWGQGGGTHSQWNKPSKPKTNMKHMAGAAAAGAVVGGLGGYVLGSAMSRPIIHFGSDYEDRYYRENMHRYPNQVYYRPMDEYSNQNNFVHDCVNITIKQHTVTTTTKGENFTETDVKMMERVVEQMCITQYERESQAYYKRGSSMVLFSSPPVILLISFLIFLIVG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T08722-Ab Anti-PRIO/ APRIO/ PRNP monoclonal antibody
    Target Antigen GM-Tg-g-T08722-Ag PRNP VLP (virus-like particle)
    ORF Viral Vector pGMLP003874 Human PRNP Lentivirus plasmid
    ORF Viral Vector vGMLP003874 Human PRNP Lentivirus particle


    Target information

    Target ID GM-T08722
    Target Name PrP/PRNP
    Gene Group Identifier
    （Target Gene ID in Homo species)         		5621
    Gene ID 100065904 (Equus caballus), 101087310 (Felis catus), 19122 (Mus musculus), 24686 (Rattus norvegicus)
    281427 (Bos taurus), 485783 (Canis lupus familiaris), 5621 (Homo sapiens), 717859 (Macaca mulatta)
    Gene Symbols & Synonyms PRNP,Prnp,PRP,prmp,PrP,PrPC,Sinc,CD230,PrPSc,Prn-i,Prn-p,PrP<C>,prP27-30,prP33-35C,Prn,prn,AltPrP,CJD,GSS,ASCR,KURU,PRIP,PrPc,p27-30,PrP27-30,PrP33-35C
    Target Alternative Names ASCR,AltPrP,CD230,CJD,GSS,KURU,PRIP,PRNP,PRP,PrP,PrP27-30,PrP33-35C,PrP,PrPC,PrPSc,PrPc,Prn,Prn-i,Prn-p,Prnp,Sinc,p27-30,prP27-30,prP33-35C,prmp,prn
    Uniprot Accession F7VJQ1,P04156,F7VJQ2,P10279,O18754,O46501,P04925,P13852,P67997
    Additional SwissProt Accessions: O18754,P04925,P13852,F7VJQ2,P10279,O46501,F7VJQ1,P04156,P67997
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG Ferroptosis
    Gene Ensembl ENSECAG00000029062, ENSMUSG00000079037, ENSBTAG00000063812, ENSCAFG00845013725, ENSG00000171867, ENSMMUG00000062847
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.