Human S1PR3/EDG-3/EDG3 ORF/cDNA clone-Lentivirus plasmid (NM_005226)

Cat. No.: pGMLP003831
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human S1PR3/EDG-3/EDG3 Lentiviral expression plasmid for S1PR3 lentivirus packaging, S1PR3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to S1PR3/EDG-3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $618.36
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003831
Gene Name S1PR3
Accession Number NM_005226
Gene ID 1903
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1137 bp
Gene Alias EDG-3,EDG3,LPB3,S1P3
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCAACTGCCCTCCCGCCGCGTCTCCAGCCGGTGCGGGGGAACGAGACCCTGCGGGAGCATTACCAGTACGTGGGGAAGTTGGCGGGCAGGCTGAAGGAGGCCTCCGAGGGCAGCACGCTCACCACCGTGCTCTTCTTGGTCATCTGCAGCTTCATCGTCTTGGAGAACCTGATGGTTTTGATTGCCATCTGGAAAAACAATAAATTTCACAACCGCATGTACTTTTTCATTGGCAACCTGGCTCTCTGCGACCTGCTGGCCGGCATCGCTTACAAGGTCAACATTCTGATGTCTGGCAAGAAGACGTTCAGCCTGTCTCCCACGGTCTGGTTCCTCAGGGAGGGCAGTATGTTCGTGGCCCTTGGGGCGTCCACCTGCAGCTTACTGGCCATCGCCATCGAGCGGCACTTGACAATGATCAAAATGAGGCCTTACGACGCCAACAAGAGGCACCGCGTCTTCCTCCTGATCGGGATGTGCTGGCTCATTGCCTTCACGCTGGGCGCCCTGCCCATTCTGGGCTGGAACTGCCTGCACAATCTCCCTGACTGCTCTACCATCCTGCCCCTCTACTCCAAGAAGTACATTGCCTTCTGCATCAGCATCTTCACGGCCATCCTGGTGACCATCGTGATCCTCTACGCACGCATCTACTTCCTGGTGAAGTCCAGCAGCCGTAAGGTGGCCAACCACAACAACTCGGAGCGGTCCATGGCACTGCTGCGGACCGTGGTGATTGTGGTGAGCGTGTTCATCGCCTGCTGGTCCCCACTCTTCATCCTCTTCCTCATTGATGTGGCCTGCAGGGTGCAGGCGTGCCCCATCCTCTTCAAGGCTCAGTGGTTCATCGTGTTGGCTGTGCTCAACTCCGCCATGAACCCGGTCATCTACACGCTGGCCAGCAAGGAGATGCGGCGGGCCTTCTTCCGTCTGGTCTGCAACTGCCTGGTCAGGGGACGGGGGGCCCGCGCCTCACCCATCCAGCCTGCGCTCGACCCAAGCAGAAGTAAATCAAGCAGCAGCAACAATAGCAGCCACTCTCCGAAGGTCAAGGAAGACCTGCCCCACACAGCCCCCTCATCCTGCATCATGGACAAGAACGCAGCACTTCAGAATGGGATCTTCTGCAACTGA
ORF Protein Sequence MATALPPRLQPVRGNETLREHYQYVGKLAGRLKEASEGSTLTTVLFLVICSFIVLENLMVLIAIWKNNKFHNRMYFFIGNLALCDLLAGIAYKVNILMSGKKTFSLSPTVWFLREGSMFVALGASTCSLLAIAIERHLTMIKMRPYDANKRHRVFLLIGMCWLIAFTLGALPILGWNCLHNLPDCSTILPLYSKKYIAFCISIFTAILVTIVILYARIYFLVKSSSRKVANHNNSERSMALLRTVVIVVSVFIACWSPLFILFLIDVACRVQACPILFKAQWFIVLAVLNSAMNPVIYTLASKEMRRAFFRLVCNCLVRGRGARASPIQPALDPSRSKSSSSNNSSHSPKVKEDLPHTAPSSCIMDKNAALQNGIFCN

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T11241-Ab Anti-S1PR3/ EDG-3/ EDG3 monoclonal antibody
    Target Antigen GM-Tg-g-T11241-Ag S1PR3 VLP (virus-like particle)
    ORF Viral Vector pGMLP003831 Human S1PR3 Lentivirus plasmid
    ORF Viral Vector vGMLP003831 Human S1PR3 Lentivirus particle


    Target information

    Target ID GM-T11241
    Target Name S1PR3
    Gene Group Identifier
    （Target Gene ID in Homo species)         		1903
    Gene ID 100061893 (Equus caballus), 111557590 (Felis catus), 13610 (Mus musculus), 1903 (Homo sapiens)
    306792 (Rattus norvegicus), 484199 (Canis lupus familiaris), 539123 (Bos taurus), 700903 (Macaca mulatta)
    Gene Symbols & Synonyms S1PR3,S1pr3,Edg3,Lpb3,S1p3,EDG3,LPB3,S1P3,EDG-3,C9orf47,C9orf108,bA791O21.3,lpb3,Edg3l
    Target Alternative Names C9orf108,C9orf47,EDG-3,EDG3,Edg3,Edg3l,Endothelial differentiation G-protein coupled receptor 3,LPB3,Lpb3,S1P receptor 3,S1P3,S1PR3,S1p3,S1pr3,Sphingosine 1-phosphate receptor 3,Sphingosine 1-phosphate receptor Edg-3 (S1P receptor Edg-3),bA791O21.3,lpb3
    Uniprot Accession Q99500,Q9Z0U9
    Additional SwissProt Accessions: Q9Z0U9,Q99500
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG Sphingolipid signaling pathway, Neuroactive ligand-receptor interaction
    Gene Ensembl ENSECAG00000003011, ENSMUSG00000067586, ENSG00000213694, ENSCAFG00845020161, ENSBTAG00000011374, ENSMMUG00000043913
    Target Classification GPCR


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.