Human FFAR1/FFA1R/GPCR40 ORF/cDNA clone-Lentivirus plasmid (NM_005303)

Cat. No.: pGMLP003785
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FFAR1/FFA1R/GPCR40 Lentiviral expression plasmid for FFAR1 lentivirus packaging, FFAR1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to FFAR1/GPR40/FFAR1/FFA1R products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $525.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003785
Gene Name FFAR1
Accession Number NM_005303
Gene ID 2864
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 903 bp
Gene Alias FFA1R,GPCR40,GPR40
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGACCTGCCCCCGCAGCTCTCCTTCGGCCTCTATGTGGCCGCCTTTGCGCTGGGCTTCCCGCTCAACGTCCTGGCCATCCGAGGCGCGACGGCCCACGCCCGGCTCCGTCTCACCCCTAGCCTGGTCTACGCCCTGAACCTGGGCTGCTCCGACCTGCTGCTGACAGTCTCTCTGCCCCTGAAGGCGGTGGAGGCGCTAGCCTCCGGGGCCTGGCCTCTGCCGGCCTCGCTGTGCCCCGTCTTCGCGGTGGCCCACTTCTTCCCACTCTATGCCGGCGGGGGCTTCCTGGCCGCCCTGAGTGCAGGCCGCTACCTGGGAGCAGCCTTCCCCTTGGGCTACCAAGCCTTCCGGAGGCCGTGCTATTCCTGGGGGGTGTGCGCGGCCATCTGGGCCCTCGTCCTGTGTCACCTGGGTCTGGTCTTTGGGTTGGAGGCTCCAGGAGGCTGGCTGGACCACAGCAACACCTCCCTGGGCATCAACACACCGGTCAACGGCTCTCCGGTCTGCCTGGAGGCCTGGGACCCGGCCTCTGCCGGCCCGGCCCGCTTCAGCCTCTCTCTCCTGCTCTTTTTTCTGCCCTTGGCCATCACAGCCTTCTGCTACGTGGGCTGCCTCCGGGCACTGGCCCGCTCCGGCCTGACGCACAGGCGGAAGCTGCGGGCCGCCTGGGTGGCCGGCGGGGCCCTCCTCACGCTGCTGCTCTGCGTAGGACCCTACAACGCCTCCAACGTGGCCAGCTTCCTGTACCCCAATCTAGGAGGCTCCTGGCGGAAGCTGGGGCTCATCACGGGTGCCTGGAGTGTGGTGCTTAATCCGCTGGTGACCGGTTACTTGGGAAGGGGTCCTGGCCTGAAGACAGTGTGTGCGGCAAGAACGCAAGGGGGCAAGTCCCAGAAGTAA
ORF Protein Sequence MDLPPQLSFGLYVAAFALGFPLNVLAIRGATAHARLRLTPSLVYALNLGCSDLLLTVSLPLKAVEALASGAWPLPASLCPVFAVAHFFPLYAGGGFLAALSAGRYLGAAFPLGYQAFRRPCYSWGVCAAIWALVLCHLGLVFGLEAPGGWLDHSNTSLGINTPVNGSPVCLEAWDPASAGPARFSLSLLLFFLPLAITAFCYVGCLRALARSGLTHRRKLRAAWVAGGALLTLLLCVGPYNASNVASFLYPNLGGSWRKLGLITGAWSVVLNPLVTGYLGRGPGLKTVCAARTQGGKSQK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T25608-Ab Anti-FFAR1/ GPR40/ FFA1R monoclonal antibody
    Target Antigen GM-Tg-g-T25608-Ag GPR40/FFAR1 VLP (virus-like particle)
    ORF Viral Vector pGMLP003785 Human FFAR1 Lentivirus plasmid
    ORF Viral Vector vGMLP003785 Human FFAR1 Lentivirus particle


    Target information

    Target ID GM-T25608
    Target Name FFAR1/GPR40
    Gene Group Identifier
    （Target Gene ID in Homo species)         		2864
    Gene ID 100059338 (Equus caballus), 101101019 (Felis catus), 233081 (Mus musculus), 266607 (Rattus norvegicus)
    2864 (Homo sapiens), 612661 (Canis lupus familiaris), 618180 (Bos taurus), 708620 (Macaca mulatta)
    Gene Symbols & Synonyms FFAR1,Ffar1,Gpr40,FFA1R,GPR40,GPCR40
    Target Alternative Names FFA1R,FFAR1,Ffar1,Free fatty acid receptor 1,G-protein coupled receptor 40,GPCR40,GPR40,Gpr40
    Uniprot Accession O14842,Q76JU9,Q8K3T4
    Additional SwissProt Accessions: Q76JU9,Q8K3T4,O14842
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG Insulin secretion
    Gene Ensembl ENSMUSG00000044453, ENSG00000126266, ENSCAFG00845003077, ENSMMUG00000062200
    Target Classification GPCR


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.