Human NR0B2/SHP/SHP1 ORF/cDNA clone-Lentivirus plasmid (NM_021969)

Cat. No.: pGMLP003773
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NR0B2/SHP/SHP1 Lentiviral expression plasmid for NR0B2 lentivirus packaging, NR0B2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to NR0B2/SHP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $493.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003773
Gene Name NR0B2
Accession Number NM_021969
Gene ID 8431
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 774 bp
Gene Alias SHP,SHP1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAGCACCAGCCAACCAGGGGCCTGCCCATGCCAGGGAGCTGCAAGCCGCCCCGCCATTCTCTACGCACTTCTGAGCTCCAGCCTCAAGGCTGTCCCCCGACCCCGTAGCCGCTGCCTATGTAGGCAGCACCGGCCCGTCCAGCTATGTGCACCTCATCGCACCTGCCGGGAGGCCTTGGATGTTCTGGCCAAGACAGTGGCCTTCCTCAGGAACCTGCCATCCTTCTGGCAGCTGCCTCCCCAGGACCAGCGGCGGCTGCTGCAGGGTTGCTGGGGCCCCCTCTTCCTGCTTGGGTTGGCCCAAGATGCTGTGACCTTTGAGGTGGCTGAGGCCCCGGTGCCCAGCATACTCAAGAAGATTCTGCTGGAGGAGCCCAGCAGCAGTGGAGGCAGTGGCCAACTGCCAGACAGACCCCAGCCCTCCCTGGCTGCGGTGCAGTGGCTTCAATGCTGTCTGGAGTCCTTCTGGAGCCTGGAGCTTAGCCCCAAGGAATATGCCTGCCTGAAAGGGACCATCCTCTTCAACCCCGATGTGCCAGGCCTCCAAGCCGCCTCCCACATTGGGCACCTGCAGCAGGAGGCTCACTGGGTGCTGTGTGAAGTCCTGGAACCCTGGTGCCCAGCAGCCCAAGGCCGCCTGACCCGTGTCCTCCTCACGGCCTCCACCCTCAAGTCCATTCCGACCAGCCTGCTTGGGGACCTCTTCTTTCGCCCTATCATTGGAGATGTTGACATCGCTGGCCTTCTTGGGGACATGCTTTTGCTCAGGTGA
ORF Protein Sequence MSTSQPGACPCQGAASRPAILYALLSSSLKAVPRPRSRCLCRQHRPVQLCAPHRTCREALDVLAKTVAFLRNLPSFWQLPPQDQRRLLQGCWGPLFLLGLAQDAVTFEVAEAPVPSILKKILLEEPSSSGGSGQLPDRPQPSLAAVQWLQCCLESFWSLELSPKEYACLKGTILFNPDVPGLQAASHIGHLQQEAHWVLCEVLEPWCPAAQGRLTRVLLTASTLKSIPTSLLGDLFFRPIIGDVDIAGLLGDMLLLR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T89859-Ab Anti-NR0B2 monoclonal antibody
    Target Antigen GM-Tg-g-T89859-Ag NR0B2 protein
    ORF Viral Vector pGMLP003773 Human NR0B2 Lentivirus plasmid
    ORF Viral Vector vGMLP003773 Human NR0B2 Lentivirus particle


    Target information

    Target ID GM-T89859
    Target Name NR0B2
    Gene Group Identifier
    (Target Gene ID in Homo species)
    8431
    Gene ID 101081062 (Felis catus), 117274 (Rattus norvegicus), 138915016 (Equus caballus), 23957 (Mus musculus)
    514770 (Bos taurus), 612125 (Canis lupus familiaris), 715170 (Macaca mulatta), 8431 (Homo sapiens)
    Gene Symbols & Synonyms NR0B2,Nr0b2,Shp,SHP,Shp1,SHP-1,SHP1
    Target Alternative Names NR0B2,Nr0b2,Nuclear receptor subfamily 0 group B member 2,Orphan nuclear receptor SHP,SHP,SHP-1,SHP1,Shp,Shp1,Small heterodimer partner
    Uniprot Accession P97947,Q15466,Q62227
    Additional SwissProt Accessions: P97947,Q62227,Q15466
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease cancer
    Disease from KEGG Bile secretion
    Gene Ensembl ENSMUSG00000037583, ENSBTAG00000014848, ENSCAFG00845011182, ENSMMUG00000010291, ENSG00000131910
    Target Classification Tumor-associated antigen (TAA)


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.