Human DRD4/D4DR ORF/cDNA clone-Lentivirus plasmid (NM_000797)

Cat. No.: pGMLP003674
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human DRD4/D4DR Lentiviral expression plasmid for DRD4 lentivirus packaging, DRD4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to DRD4/D4R/DRD4/D4DR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $652.8
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003674
Gene Name DRD4
Accession Number NM_000797
Gene ID 1815
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1260 bp
Gene Alias D4DR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGAACCGCAGCACCGCGGACGCGGACGGGCTGCTGGCTGGGCGCGGGCCGGCCGCGGGGGCATCTGCGGGGGCATCTGCGGGGCTGGCTGGGCAGGGCGCGGCGGCGCTGGTGGGGGGCGTGCTGCTCATCGGCGCGGTGCTCGCGGGGAACTCGCTCGTGTGCGTGAGCGTGGCCACCGAGCGCGCCCTGCAGACGCCCACCAACTCCTTCATCGTGAGCCTGGCGGCCGCCGACCTCCTCCTCGCTCTCCTGGTGCTGCCGCTCTTCGTCTACTCCGAGGTCCAGGGTGGCGCGTGGCTGCTGAGCCCCCGCCTGTGCGACGCCCTCATGGCCATGGACGTCATGCTGTGCACCGCCTCCATCTTCAACCTGTGCGCCATCAGCGTGGACAGGTTCGTGGCCGTGGCCGTGCCGCTGCGCTACAACCGGCAGGGTGGGAGCCGCCGGCAGCTGCTGCTCATCGGCGCCACGTGGCTGCTGTCCGCGGCGGTGGCGGCGCCCGTACTGTGCGGCCTCAACGACGTGCGCGGCCGCGACCCCGCCGTGTGCCGCCTGGAGGACCGCGACTACGTGGTCTACTCGTCCGTGTGCTCCTTCTTCCTACCCTGCCCGCTCATGCTGCTGCTCTACTGGGCCACGTTCCGCGGCCTGCAGCGCTGGGAGGTGGCACGTCGCGCCAAGCTGCACGGCCGCGCGCCCCGCCGACCCAGCGGCCCTGGCCCGCCTTCCCCCACGCCACCCGCGCCCCGCCTCCCCCAGGACCCCTGCGGCCCCGACTGTGCGCCCCCCGCGCCCGGCCTTCCCCGGGGTCCCTGCGGCCCCGACTGTGCGCCCGCCGCGCCCAGCCTCCCCCAGGACCCCTGCGGCCCCGACTGTGCGCCCCCCGCGCCCGGCCTCCCCCCGGACCCCTGCGGCTCCAACTGTGCTCCCCCCGACGCCGTCAGAGCCGCCGCGCTCCCACCCCAGACTCCACCGCAGACCCGCAGGAGGCGGCGTGCCAAGATCACCGGCCGGGAGCGCAAGGCCATGAGGGTCCTGCCGGTGGTGGTCGGGGCCTTCCTGCTGTGCTGGACGCCCTTCTTCGTGGTGCACATCACGCAGGCGCTGTGTCCTGCCTGCTCCGTGCCCCCGCGGCTGGTCAGCGCCGTCACCTGGCTGGGCTACGTCAACAGCGCCCTCAACCCCGTCATCTACACTGTCTTCAACGCCGAGTTCCGCAACGTCTTCCGCAAGGCCCTGCGTGCCTGCTGCTGA
ORF Protein Sequence MGNRSTADADGLLAGRGPAAGASAGASAGLAGQGAAALVGGVLLIGAVLAGNSLVCVSVATERALQTPTNSFIVSLAAADLLLALLVLPLFVYSEVQGGAWLLSPRLCDALMAMDVMLCTASIFNLCAISVDRFVAVAVPLRYNRQGGSRRQLLLIGATWLLSAAVAAPVLCGLNDVRGRDPAVCRLEDRDYVVYSSVCSFFLPCPLMLLLYWATFRGLQRWEVARRAKLHGRAPRRPSGPGPPSPTPPAPRLPQDPCGPDCAPPAPGLPRGPCGPDCAPAAPSLPQDPCGPDCAPPAPGLPPDPCGSNCAPPDAVRAAALPPQTPPQTRRRRRAKITGRERKAMRVLPVVVGAFLLCWTPFFVVHITQALCPACSVPPRLVSAVTWLGYVNSALNPVIYTVFNAEFRNVFRKALRACC

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T24983-Ab Anti-DRD4/ D4R/ D4DR monoclonal antibody
    Target Antigen GM-Tg-g-T24983-Ag D4R/DRD4 VLP (virus-like particle)
    ORF Viral Vector pGMLP003674 Human DRD4 Lentivirus plasmid
    ORF Viral Vector vGMLP003674 Human DRD4 Lentivirus particle


    Target information

    Target ID GM-T24983
    Target Name DRD4/D4R
    Gene Group Identifier
    （Target Gene ID in Homo species)         		1815
    Gene ID 100147552 (Equus caballus), 101906668 (Bos taurus), 111556768 (Felis catus), 119864199 (Canis lupus familiaris)
    13491 (Mus musculus), 1815 (Homo sapiens), 25432 (Rattus norvegicus), 699697 (Macaca mulatta)
    Gene Symbols & Synonyms DRD4,Drd4,D4R,Drd-4,D4DR,D4RA
    Target Alternative Names D(2C) dopamine receptor,D(4) dopamine receptor,D4DR,D4R,D4RA,DRD4,Dopamine D4 receptor,Drd-4,Drd4
    Uniprot Accession P21917,P30729,P51436
    Additional SwissProt Accessions: P51436,P21917,P30729
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG Neuroactive ligand-receptor interaction
    Gene Ensembl ENSECAG00000010137, ENSBTAG00000051042, ENSCAFG00845017368, ENSMUSG00000025496, ENSG00000069696
    Target Classification GPCR


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.