Human KCNK3/K2p3.1/OAT1 ORF/cDNA clone-Lentivirus plasmid (NM_002246)

Cat. No.: pGMLP003639
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human KCNK3/K2p3.1/OAT1 Lentiviral expression plasmid for KCNK3 lentivirus packaging, KCNK3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to KCNK3/TASK1/KCNK3/K2p3.1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $631.8
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003639
Gene Name KCNK3
Accession Number NM_002246
Gene ID 3777
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1185 bp
Gene Alias K2p3.1,OAT1,PPH4,TASK,TASK-1,TBAK1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGCGGCAGAACGTGCGCACGCTGGCGCTCATCGTGTGCACCTTCACCTACCTGCTGGTGGGCGCCGCGGTCTTCGACGCGCTGGAGTCGGAGCCCGAGCTGATCGAGCGGCAGCGGCTGGAGCTGCGGCAGCAGGAGCTGCGGGCGCGCTACAACCTCAGCCAGGGCGGCTACGAGGAGCTGGAGCGCGTCGTGCTGCGCCTCAAGCCGCACAAGGCCGGCGTGCAGTGGCGCTTCGCCGGCTCCTTCTACTTCGCCATCACCGTCATCACCACCATCGGCTACGGGCACGCGGCACCCAGCACGGATGGCGGCAAGGTGTTCTGCATGTTCTACGCGCTGCTGGGCATCCCGCTCACGCTCGTCATGTTCCAGAGCCTGGGCGAGCGCATCAACACCTTGGTGAGGTACCTGCTGCACCGCGCCAAGAAGGGGCTGGGCATGCGGCGCGCCGACGTGTCCATGGCCAACATGGTGCTCATCGGCTTCTTCTCGTGCATCAGCACGCTGTGCATCGGCGCCGCCGCCTTCTCCCACTACGAGCACTGGACCTTCTTCCAGGCCTACTACTACTGCTTCATCACCCTCACCACCATCGGCTTCGGCGACTACGTGGCGCTGCAGAAGGACCAGGCCCTGCAGACGCAGCCGCAGTACGTGGCCTTCAGCTTCGTCTACATCCTTACGGGCCTCACGGTCATCGGCGCCTTCCTCAACCTCGTGGTGCTGCGCTTCATGACCATGAACGCCGAGGACGAGAAGCGCGACGCCGAGCACCGCGCGCTGCTCACGCGCAACGGGCAGGCGGGCGGCGGCGGAGGGGGTGGCAGCGCGCACACTACGGACACCGCCTCATCCACGGCGGCAGCGGGCGGCGGCGGCTTCCGCAACGTCTACGCGGAGGTGCTGCACTTCCAGTCCATGTGCTCGTGCCTGTGGTACAAGAGCCGCGAGAAGCTGCAGTACTCCATCCCCATGATCATCCCGCGGGACCTCTCCACGTCCGACACGTGCGTGGAGCAGAGCCACTCGTCGCCGGGAGGGGGCGGCCGCTACAGCGACACGCCCTCGCGACGCTGCCTGTGCAGCGGGGCGCCACGCTCCGCCATCAGCTCGGTGTCCACGGGTCTGCACAGCCTGTCCACCTTCCGCGGCCTCATGAAGCGCAGGAGCTCCGTGTGA
ORF Protein Sequence MKRQNVRTLALIVCTFTYLLVGAAVFDALESEPELIERQRLELRQQELRARYNLSQGGYEELERVVLRLKPHKAGVQWRFAGSFYFAITVITTIGYGHAAPSTDGGKVFCMFYALLGIPLTLVMFQSLGERINTLVRYLLHRAKKGLGMRRADVSMANMVLIGFFSCISTLCIGAAAFSHYEHWTFFQAYYYCFITLTTIGFGDYVALQKDQALQTQPQYVAFSFVYILTGLTVIGAFLNLVVLRFMTMNAEDEKRDAEHRALLTRNGQAGGGGGGGSAHTTDTASSTAAAGGGGFRNVYAEVLHFQSMCSCLWYKSREKLQYSIPMIIPRDLSTSDTCVEQSHSSPGGGGRYSDTPSRRCLCSGAPRSAISSVSTGLHSLSTFRGLMKRRSSV

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T15795-Ab Anti-KCNK3/ TASK1/ K2p3.1 monoclonal antibody
    Target Antigen GM-Tg-g-T15795-Ag TASK1/KCNK3 VLP (virus-like particle)
    ORF Viral Vector pGMLP003639 Human KCNK3 Lentivirus plasmid
    ORF Viral Vector vGMLP003639 Human KCNK3 Lentivirus particle


    Target information

    Target ID GM-T15795
    Target Name KCNK3/TASK1
    Gene Group Identifier
    (Target Gene ID in Homo species)
    3777
    Gene ID 101082745 (Felis catus), 102150125 (Equus caballus), 16527 (Mus musculus), 29553 (Rattus norvegicus)
    3777 (Homo sapiens), 483002 (Canis lupus familiaris), 519188 (Bos taurus), 699287 (Macaca mulatta)
    Gene Symbols & Synonyms KCNK3,Kcnk3,TASK,Task-1,cTBAK-1,rTASK,OAT1,PPH4,TASK1,TBAK1,K2p3.1,TASK-1
    Target Alternative Names Acid-sensitive potassium channel protein TASK-1,K2p3.1,KCNK3,Kcnk3,OAT1,PPH4,Potassium channel subfamily K member 3,TASK,TASK-1,TASK1,TBAK1,TWIK-related acid-sensitive K(+) channel 1,Task-1,Two pore potassium channel KT3.1 (Two pore K(+) channel KT3.1),cTBAK-1,rTASK
    Uniprot Accession O14649,O35111,O54912
    Additional SwissProt Accessions: O35111,O54912,O14649
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG Aldosterone synthesis and secretion, Cortisol synthesis and secretion, Cushing syndrome
    Gene Ensembl ENSECAG00000038775, ENSMUSG00000049265, ENSG00000171303, ENSCAFG00845028885, ENSBTAG00000051102, ENSMMUG00000056208
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.