Human OXTR/OT-R ORF/cDNA clone-Lentivirus plasmid (NM_000916)

Cat. No.: pGMLP003633
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human OXTR/OT-R Lentiviral expression plasmid for OXTR lentivirus packaging, OXTR lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to OXTR/OTR/OXTR/OT-R products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $627.6
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003633
Gene Name OXTR
Accession Number NM_000916
Gene ID 5021
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1170 bp
Gene Alias OT-R
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGGGCGCGCTCGCAGCCAACTGGAGCGCCGAGGCAGCCAACGCCAGCGCCGCGCCGCCGGGGGCCGAGGGCAACCGCACCGCCGGACCCCCGCGGCGCAACGAGGCCCTGGCGCGCGTGGAGGTGGCGGTGCTGTGTCTCATCCTGCTCCTGGCGCTGAGCGGGAACGCGTGTGTGCTGCTGGCGCTGCGCACCACACGCCAGAAGCACTCGCGCCTCTTCTTCTTCATGAAGCACCTAAGCATCGCCGACCTGGTGGTGGCAGTGTTTCAGGTGCTGCCGCAGTTGCTGTGGGACATCACCTTCCGCTTCTACGGGCCCGACCTGCTGTGCCGCCTGGTCAAGTACTTGCAGGTGGTGGGCATGTTCGCCTCCACCTACCTGCTGCTGCTCATGTCCCTGGACCGCTGCCTGGCCATCTGCCAGCCGCTGCGCTCGCTGCGCCGCCGCACCGACCGCCTGGCAGTGCTCGCCACGTGGCTCGGCTGCCTGGTGGCCAGCGCGCCGCAGGTGCACATCTTCTCTCTGCGCGAGGTGGCTGACGGCGTCTTCGACTGCTGGGCCGTCTTCATCCAGCCCTGGGGACCCAAGGCCTACATCACATGGATCACGCTAGCTGTCTACATCGTGCCGGTCATCGTGCTCGCTGCCTGCTACGGCCTTATCAGCTTCAAGATCTGGCAGAACTTGCGGCTCAAGACCGCTGCAGCGGCGGCGGCCGAGGCGCCAGAGGGCGCGGCGGCTGGCGATGGGGGGCGCGTGGCCCTGGCGCGTGTCAGCAGCGTCAAGCTCATCTCCAAGGCCAAGATCCGCACGGTCAAGATGACTTTCATCATCGTGCTGGCCTTCATCGTGTGCTGGACGCCTTTCTTCTTCGTGCAGATGTGGAGCGTCTGGGATGCCAACGCGCCCAAGGAAGCCTCGGCCTTCATCATCGTCATGCTCCTGGCCAGCCTCAACAGCTGCTGCAACCCCTGGATCTACATGCTGTTCACGGGCCACCTCTTCCACGAACTCGTGCAGCGCTTCCTGTGCTGCTCCGCCAGCTACCTGAAGGGCAGACGCCTGGGAGAGACGAGTGCCAGCAAAAAGAGCAACTCGTCCTCCTTTGTCCTGAGCCATCGCAGCTCCAGCCAGAGGAGCTGCTCCCAGCCATCCACGGCGTGA
ORF Protein Sequence MEGALAANWSAEAANASAAPPGAEGNRTAGPPRRNEALARVEVAVLCLILLLALSGNACVLLALRTTRQKHSRLFFFMKHLSIADLVVAVFQVLPQLLWDITFRFYGPDLLCRLVKYLQVVGMFASTYLLLLMSLDRCLAICQPLRSLRRRTDRLAVLATWLGCLVASAPQVHIFSLREVADGVFDCWAVFIQPWGPKAYITWITLAVYIVPVIVLAACYGLISFKIWQNLRLKTAAAAAAEAPEGAAAGDGGRVALARVSSVKLISKAKIRTVKMTFIIVLAFIVCWTPFFFVQMWSVWDANAPKEASAFIIVMLLASLNSCCNPWIYMLFTGHLFHELVQRFLCCSASYLKGRRLGETSASKKSNSSSFVLSHRSSSQRSCSQPSTA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T84486-Ab Anti-OXYR/ OTR/ OXTR monoclonal antibody
    Target Antigen GM-Tg-g-T84486-Ag OTR/OXTR VLP (virus-like particle)
    ORF Viral Vector pGMLP003633 Human OXTR Lentivirus plasmid
    ORF Viral Vector vGMLP003633 Human OXTR Lentivirus particle


    Target information

    Target ID GM-T84486
    Target Name OXTR/OTR
    Gene Group Identifier
    (Target Gene ID in Homo species)
    5021
    Gene ID 101081711 (Felis catus), 106781784 (Equus caballus), 18430 (Mus musculus), 25342 (Rattus norvegicus)
    281371 (Bos taurus), 484670 (Canis lupus familiaris), 5021 (Homo sapiens), 702048 (Macaca mulatta)
    Gene Symbols & Synonyms OXTR,Oxtr,OTR,OT-R,OTR1
    Target Alternative Names OXTR, OTR,Oxytocin receptor,OT-R,OTR,OT-R
    Uniprot Accession P30559,P56449,P56494,P70536,P97926
    Additional SwissProt Accessions: P97926,P70536,P56449,P30559,P56494
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target
    Disease
    Disease from KEGG Calcium signaling pathway, cAMP signaling pathway, Neuroactive ligand-receptor interaction, Oxytocin signaling pathway
    Gene Ensembl ENSMUSG00000049112, ENSCAFG00845010546, ENSG00000180914, ENSMMUG00000009703
    Target Classification GPCR


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.