Human NAAA/ASAHL/PLT ORF/cDNA clone-Lentivirus plasmid (NM_014435)

Cat. No.: pGMLP003588
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human NAAA/ASAHL/PLT Lentiviral expression plasmid for NAAA lentivirus packaging, NAAA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to NAAA/ASAHL products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $602.4
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003588
Gene Name NAAA
Accession Number NM_014435
Gene ID 27163
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1080 bp
Gene Alias ASAHL,PLT
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCGGACCGCGGACCGGGAGGCGCGCCCGGGGCTTCCGTCCCTGCTGCTGCTGCTGCTGGCCGGGGCCGGGCTGTCAGCCGCCTCGCCCCCAGCAGCGCCGCGCTTCAACGTGAGCCTGGACTCGGTCCCCGAGCTGCGCTGGCTGCCCGTGCTGCGGCACTACGACTTGGACTTGGTGCGCGCCGCGATGGCGCAAGTCATCGGGGACAGAGTCCCCAAGTGGGTGCACGTGTTAATCGGAAAAGTGGTCCTGGAGCTGGAGCGCTTCCTGCCCCAGCCCTTCACCGGCGAGATCCGCGGCATGTGTGACTTCATGAACCTCAGCCTGGCGGACTGCCTTCTGGTCAACCTGGCCTACGAGTCCTCCGTGTTCTGCACCAGTATTGTGGCTCAAGACTCCAGAGGCCACATTTACCATGGTCGGAATTTGGATTATCCTTTTGGGAATGTCTTACGCAAGCTGACAGTGGATGTGCAATTCTTAAAGAATGGGCAGATTGCATTCACAGGAACTACTTTTATTGGCTATGTAGGATTATGGACTGGCCAGAGCCCACACAAGTTTACAGTTTCTGGTGATGAACGAGATAAAGGCTGGTGGTGGGAGAATGCTATCGCTGCCCTGTTTCGGAGACACATTCCCGTCAGCTGGCTGATCCGCGCTACCCTGAGTGAGTCGGAAAACTTCGAAGCAGCTGTTGGCAAGTTGGCCAAGACTCCCCTTATTGCTGATGTTTATTACATTGTTGGTGGCACGTCCCCCCGGGAGGGGGTGGTCATCACGAGGAACAGAGATGGCCCAGCAGACATTTGGCCTCTAGATCCTTTGAATGGAGCGTGGTTCCGAGTTGAGACAAATTACGACCACTGGAAGCCAGCACCCAAGGAAGATGACCGGAGAACATCTGCCATCAAGGCCCTTAATGCTACAGGACAAGCAAACCTCAGCCTGGAGGCACTTTTCCAGATTTTGTCGGTGGTTCCAGTTTATAACAACTTCACAATTTATACTACGGTAATGAGCGCCGGTAGCCCAGACAAGTACATGACTAGGATCAGAAACCCGAGTAGAAAGTAA
ORF Protein Sequence MRTADREARPGLPSLLLLLLAGAGLSAASPPAAPRFNVSLDSVPELRWLPVLRHYDLDLVRAAMAQVIGDRVPKWVHVLIGKVVLELERFLPQPFTGEIRGMCDFMNLSLADCLLVNLAYESSVFCTSIVAQDSRGHIYHGRNLDYPFGNVLRKLTVDVQFLKNGQIAFTGTTFIGYVGLWTGQSPHKFTVSGDERDKGWWWENAIAALFRRHIPVSWLIRATLSESENFEAAVGKLAKTPLIADVYYIVGGTSPREGVVITRNRDGPADIWPLDPLNGAWFRVETNYDHWKPAPKEDDRRTSAIKALNATGQANLSLEALFQILSVVPVYNNFTIYTTVMSAGSPDKYMTRIRNPSRK

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T78326-Ab Anti-NAAA/ ASAHL/ PLT functional antibody
    Target Antigen GM-Tg-g-T78326-Ag NAAA protein
    ORF Viral Vector pGMLP003588 Human NAAA Lentivirus plasmid
    ORF Viral Vector vGMLP003588 Human NAAA Lentivirus particle


    Target information

    Target ID GM-T78326
    Target Name NAAA
    Gene Group Identifier
    (Target Gene ID in Homo species)
    27163
    Gene ID 100057831 (Equus caballus), 101091867 (Felis catus), 27163 (Homo sapiens), 497009 (Rattus norvegicus)
    515375 (Bos taurus), 67111 (Mus musculus), 700991 (Macaca mulatta)
    Gene Symbols & Synonyms NAAA,Naaa,PLT,ASAHL,Asahl,2210023K21Rik,3830414F09Rik
    Target Alternative Names 2210023K21Rik,3830414F09Rik,ASAHL,Acid ceramidase-like protein,Acylsphingosine deacylase NAAA,Asahl,N-acylethanolamine-hydrolyzing acid amidase,N-acylsphingosine amidohydrolase-like (ASAH-like protein),NAAA,Naaa,PLT
    Uniprot Accession Q02083,Q5KTC7,Q9D7V9
    Additional SwissProt Accessions: Q02083,Q5KTC7,Q9D7V9
    Uniprot Entry Name
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease
    Disease from KEGG
    Gene Ensembl ENSECAG00000005265, ENSG00000138744, ENSBTAG00000019478, ENSMUSG00000029413, ENSMMUG00000017501
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.