Human G6PC3/SCN4/UGRP ORF/cDNA clone-Lentivirus plasmid (NM_138387)

Cat. No.: pGMLP003565
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human G6PC3/SCN4/UGRP Lentiviral expression plasmid for G6PC3 lentivirus packaging, G6PC3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to G6PC3/SCN4 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $591.48
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003565
Gene Name G6PC3
Accession Number NM_138387
Gene ID 92579
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1041 bp
Gene Alias SCN4,UGRP
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGTCCACGCTGGGCGCGGGCATCGTGATAGCCGAGGCGCTACAGAACCAGCTAGCCTGGCTGGAGAACGTGTGGCTCTGGATCACCTTTCTGGGCGATCCCAAGATCCTCTTTCTGTTCTACTTCCCCGCGGCCTACTACGCCTCCCGCCGTGTGGGCATCGCGGTGCTCTGGATCAGCCTCATCACCGAGTGGCTCAACCTCATCTTCAAGTGGTTTCTTTTTGGAGACAGGCCCTTTTGGTGGGTCCATGAGTCTGGTTACTACAGCCAGGCTCCAGCCCAGGTTCACCAGTTCCCCTCTTCTTGTGAGACTGGTCCAGGCAGCCCTTCTGGACACTGCATGATCACAGGAGCAGCCCTCTGGCCCATAATGACGGCCCTGTCTTCGCAGGTGGCCACTCGGGCCCGCAGCCGCTGGGTAAGGGTGATGCCTAGCCTGGCTTATTGCACCTTCCTTTTGGCGGTTGGCTTGTCGCGAATCTTCATCTTAGCACATTTCCCTCACCAGGTGCTGGCTGGCCTAATAACTGGCGCTGTCCTGGGCTGGCTGATGACTCCCCGAGTGCCTATGGAGCGGGAGCTAAGCTTCTATGGGTTGACTGCACTGGCCCTCATGCTAGGCACCAGCCTCATCTATTGGACCCTCTTTACACTGGGCCTGGATCTTTCTTGGTCCATCAGCCTAGCCTTCAAGTGGTGTGAGCGGCCTGAGTGGATACACGTGGATAGCCGGCCCTTTGCCTCCCTGAGCCGTGACTCAGGGGCTGCCCTGGGCCTGGGCATTGCCTTGCACTCTCCCTGCTATGCCCAGGTGCGTCGGGCACAGCTGGGAAATGGCCAGAAGATAGCCTGCCTTGTGCTGGCCATGGGGCTGCTGGGCCCCCTGGACTGGCTGGGCCACCCCCCTCAGATCAGCCTCTTCTACATTTTCAATTTCCTCAAGTACACCCTCTGGCCATGCCTAGTCCTGGCCCTCGTGCCCTGGGCAGTGCACATGTTCAGTGCCCAGGAAGCACCGCCCATCCACTCTTCCTGA
ORF Protein Sequence MESTLGAGIVIAEALQNQLAWLENVWLWITFLGDPKILFLFYFPAAYYASRRVGIAVLWISLITEWLNLIFKWFLFGDRPFWWVHESGYYSQAPAQVHQFPSSCETGPGSPSGHCMITGAALWPIMTALSSQVATRARSRWVRVMPSLAYCTFLLAVGLSRIFILAHFPHQVLAGLITGAVLGWLMTPRVPMERELSFYGLTALALMLGTSLIYWTLFTLGLDLSWSISLAFKWCERPEWIHVDSRPFASLSRDSGAALGLGIALHSPCYAQVRRAQLGNGQKIACLVLAMGLLGPLDWLGHPPQISLFYIFNFLKYTLWPCLVLALVPWAVHMFSAQEAPPIHSS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0877-Ab Anti-G6PC3 monoclonal antibody
    Target Antigen GM-Tg-g-IP0877-Ag G6PC3 protein
    ORF Viral Vector pGMLP003565 Human G6PC3 Lentivirus plasmid
    ORF Viral Vector vGMLP003565 Human G6PC3 Lentivirus particle


    Target information

    Target ID GM-IP0877
    Target Name G6PC3
    Gene Group Identifier
    （Target Gene ID in Homo species)         		92579
    Gene ID 100064862 (Equus caballus), 101097770 (Felis catus), 303565 (Rattus norvegicus), 369023 (Bos taurus)
    490942 (Canis lupus familiaris), 68401 (Mus musculus), 714276 (Macaca mulatta), 92579 (Homo sapiens)
    Gene Symbols & Synonyms G6PC3,G6pc3,UGRP,0710001K01Rik,SCN4
    Target Alternative Names 0710001K01Rik,G-6-Pase 3,G6PC3,G6Pase 3,G6pc3,Glucose-6-phosphatase 3,Glucose-6-phosphatase beta (G6Pase-beta),SCN4,UGRP,Ubiquitous glucose-6-phosphatase catalytic subunit-related protein
    Uniprot Accession Q148G2,Q6AZ83,Q6NSQ9,Q9BUM1
    Additional SwissProt Accessions: Q6AZ83,Q148G2,Q6NSQ9,Q9BUM1
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG Metabolic pathways, FoxO signaling pathway, PI3K-Akt signaling pathway, Adipocytokine signaling pathway, Insulin resistance, Carbohydrate digestion and absorption
    Gene Ensembl ENSBTAG00000016253, ENSCAFG00845009701, ENSMUSG00000034793, ENSMMUG00000050615, ENSG00000141349
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.