Human FUT7/FucT-VII ORF/cDNA clone-Lentivirus plasmid (NM_004479)

Cat. No.: pGMLP003556
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FUT7/FucT-VII Lentiviral expression plasmid for FUT7 lentivirus packaging, FUT7 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to FUT7/FucT-VII products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $588.12
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003556
Gene Name FUT7
Accession Number NM_004479
Gene ID 2529
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1029 bp
Gene Alias FucT-VII
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAATAATGCTGGGCACGGCCCCACCCGGAGGCTGCGAGGCTTGGGGGTCCTGGCCGGGGTGGCTCTGCTCGCTGCCCTCTGGCTCCTGTGGCTGCTGGGGTCAGCCCCTCGGGGTACCCCGGCACCCCAGCCCACGATCACCATCCTTGTCTGGCACTGGCCCTTCACTGACCAGCCCCCAGAGCTGCCCAGCGACACCTGCACCCGCTACGGCATCGCCCGCTGCCACCTGAGTGCCAACCGAAGCCTGCTGGCCAGCGCCGACGCCGTGGTCTTCCACCACCGCGAGCTGCAGACCCGGCGGTCCCACCTGCCCCTGGCCCAGCGGCCGCGAGGGCAGCCCTGGGTGTGGGCCTCCATGGAGTCTCCTAGCCACACCCACGGCCTCAGCCACCTCCGAGGCATCTTCAACTGGGTGCTGAGCTACCGGCGCGACTCGGACATCTTTGTGCCCTATGGCCGCCTGGAGCCCCACTGGGGGCCCTCGCCACCGCTGCCAGCCAAGAGCAGGGTGGCCGCCTGGGTGGTCAGCAACTTCCAGGAGCGGCAGCTGCGTGCCAGGCTGTACCGGCAGCTGGCGCCTCATCTGCGGGTGGATGTCTTTGGCCGTGCCAATGGACGGCCACTGTGCGCCAGCTGCCTGGTGCCCACCGTGGCCCAGTACCGCTTCTACCTGTCCTTTGAGAACTCTCAGCACCGCGACTACATTACGGAGAAATTCTGGCGCAACGCACTGGTGGCTGGCACTGTGCCAGTGGTGCTGGGGCCCCCACGGGCCACCTATGAGGCCTTCGTGCCGGCTGACGCCTTCGTGCATGTGGATGACTTTGGCTCAGCCCGAGAGCTGGCGGCTTTCCTCACTGGCATGAATGAGAGCCGATACCAACGCTTCTTTGCCTGGCGTGACAGGCTCCGCGTGCGACTGTTCACCGACTGGCGGGAACGTTTCTGTGCCATCTGTGACCGCTACCCACACCTACCCCGCAGCCAAGTCTATGAGGACCTTGAGGGTTGGTTTCAGGCCTGA
ORF Protein Sequence MNNAGHGPTRRLRGLGVLAGVALLAALWLLWLLGSAPRGTPAPQPTITILVWHWPFTDQPPELPSDTCTRYGIARCHLSANRSLLASADAVVFHHRELQTRRSHLPLAQRPRGQPWVWASMESPSHTHGLSHLRGIFNWVLSYRRDSDIFVPYGRLEPHWGPSPPLPAKSRVAAWVVSNFQERQLRARLYRQLAPHLRVDVFGRANGRPLCASCLVPTVAQYRFYLSFENSQHRDYITEKFWRNALVAGTVPVVLGPPRATYEAFVPADAFVHVDDFGSARELAAFLTGMNESRYQRFFAWRDRLRVRLFTDWRERFCAICDRYPHLPRSQVYEDLEGWFQA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0870-Ab Anti-FUT7 monoclonal antibody
    Target Antigen GM-Tg-g-IP0870-Ag FUT7 protein
    ORF Viral Vector pGMLP003556 Human FUT7 Lentivirus plasmid
    ORF Viral Vector vGMLP003556 Human FUT7 Lentivirus particle


    Target information

    Target ID GM-IP0870
    Target Name FUT7
    Gene Group Identifier
    (Target Gene ID in Homo species)
    2529
    Gene ID 100036592 (Bos taurus), 100067846 (Equus caballus), 105261143 (Felis catus), 14347 (Mus musculus)
    2529 (Homo sapiens), 296564 (Rattus norvegicus), 449026 (Canis lupus familiaris), 720913 (Macaca mulatta)
    Gene Symbols & Synonyms FUT7,Fut7,Fuc-TVII,FucT-VII,FTVII
    Target Alternative Names FUT7,Alpha-(1,3)-fucosyltransferase 7,Fucosyltransferase 7, Fucosyltransferase VII (Fuc-TVII, FucT-VII), Galactoside 3-L-fucosyltransferase, Selectin ligand synthase,FucT-VII
    Uniprot Accession G3MZR2,Q11130,Q11131,Q712G6
    Additional SwissProt Accessions: G3MZR2,Q11131,Q11130,Q712G6
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category
    Disease
    Disease from KEGG Metabolic pathways, Glycosphingolipid biosynthesis - lacto and neolacto series
    Gene Ensembl ENSECAG00000016839, ENSMUSG00000036587, ENSG00000180549, ENSCAFG00845025345, ENSMMUG00000040671
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.