Human ADORA3/A3AR ORF/cDNA clone-Lentivirus plasmid (NM_000677)

Cat. No.: pGMLP003536
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ADORA3/A3AR Lentiviral expression plasmid for ADORA3 lentivirus packaging, ADORA3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to ADORA3/A3AR products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $539.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003536
Gene Name ADORA3
Accession Number NM_000677
Gene ID 140
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 957 bp
Gene Alias A3AR
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCCAACAACAGCACTGCTCTGTCATTGGCCAATGTTACCTACATCACCATGGAAATTTTCATTGGACTCTGCGCCATAGTGGGCAACGTGCTGGTCATCTGCGTGGTCAAGCTGAACCCCAGCCTGCAGACCACCACCTTCTATTTCATTGTCTCTCTAGCCCTGGCTGACATTGCTGTTGGGGTGCTGGTCATGCCTTTGGCCATTGTTGTCAGCCTGGGCATCACAATCCACTTCTACAGCTGCCTTTTTATGACTTGCCTACTGCTTATCTTTACCCACGCCTCCATCATGTCCTTGCTGGCCATCGCTGTGGACCGATACTTGCGGGTCAAGCTTACCGTCAGATACAAGAGGGTCACCACTCACAGAAGAATATGGCTGGCCCTGGGCCTTTGCTGGCTGGTGTCATTCCTGGTGGGATTGACCCCCATGTTTGGCTGGAACATGAAACTGACCTCAGAGTACCACAGAAATGTCACCTTCCTTTCATGCCAATTTGTTTCCGTCATGAGAATGGACTACATGGTATACTTCAGCTTCCTCACCTGGATTTTCATCCCCCTGGTTGTCATGTGCGCCATCTATCTTGACATCTTTTACATCATTCGGAACAAACTCAGTCTGAACTTATCTAACTCCAAAGAGACAGGTGCATTTTATGGACGGGAGTTCAAGACGGCTAAGTCCTTGTTTCTGGTTCTTTTCTTGTTTGCTCTGTCATGGCTGCCTTTATCTATCATCAACTGCATCATCTACTTTAATGGTGAGGTACCACAGCTTGTGCTGTACATGGGCATCCTGCTGTCCCATGCCAACTCCATGATGAACCCTATCGTCTATGCCTATAAAATAAAGAAGTTCAAGGAAACCTACCTTTTGATCCTCAAAGCTTGTGTGGTCTGCCATCCCTCTGATTCTTTGGACACAAGCATTGAGAAGAATTCTGAGTAG
ORF Protein Sequence MPNNSTALSLANVTYITMEIFIGLCAIVGNVLVICVVKLNPSLQTTTFYFIVSLALADIAVGVLVMPLAIVVSLGITIHFYSCLFMTCLLLIFTHASIMSLLAIAVDRYLRVKLTVRYKRVTTHRRIWLALGLCWLVSFLVGLTPMFGWNMKLTSEYHRNVTFLSCQFVSVMRMDYMVYFSFLTWIFIPLVVMCAIYLDIFYIIRNKLSLNLSNSKETGAFYGREFKTAKSLFLVLFLFALSWLPLSIINCIIYFNGEVPQLVLYMGILLSHANSMMNPIVYAYKIKKFKETYLLILKACVVCHPSDSLDTSIEKNSE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T36059-Ab Anti-AA3R/ ADORA3/ A3AR monoclonal antibody
    Target Antigen GM-Tg-g-T36059-Ag ADORA3 VLP (virus-like particle)
    ORF Viral Vector pGMLP003536 Human ADORA3 Lentivirus plasmid
    ORF Viral Vector vGMLP003536 Human ADORA3 Lentivirus particle


    Target information

    Target ID GM-T36059
    Target Name ADORA3
    Gene Group Identifier
    (Target Gene ID in Homo species)
    140
    Gene ID 100911796 (Rattus norvegicus), 101094689 (Felis catus), 11542 (Mus musculus), 138803069 (Equus caballus)
    140 (Homo sapiens), 403805 (Canis lupus familiaris)
    Gene Symbols & Synonyms Adora3,ADORA3,A3,TGPCR1,A3R,A3AR,AA3R,ARA3,Gpcr2
    Target Alternative Names A3,A3AR,A3R,AA3R,ADORA3,ARA3,Adenosine receptor A3,Adora3,Gpcr2,TGPCR1
    Uniprot Accession P0DMS8,Q28309,Q61618
    Additional SwissProt Accessions: Q61618,P0DMS8,Q28309
    Uniprot Entry Name
    Protein Sub-location Transmembrane Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease
    Disease from KEGG cGMP-PKG signaling pathway, Sphingolipid signaling pathway, Neuroactive ligand-receptor interaction
    Gene Ensembl ENSMUSG00000000562, ENSG00000282608, ENSCAFG00845008429
    Target Classification GPCR, Checkpoint-Immuno Oncology


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.