Human CRYGD/CACA/CCA3 ORF/cDNA clone-Lentivirus plasmid (NM_006891)

Cat. No.: pGMLP003419
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human CRYGD/CACA/CCA3 Lentiviral expression plasmid for CRYGD lentivirus packaging, CRYGD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to CRYGD/CACA products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $431.25
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLP003419
Gene Name CRYGD
Accession Number NM_006891
Gene ID 1421
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 525 bp
Gene Alias CACA,CCA3,CCP,cry-g-D,CRYG4,CTRCT4,PCC
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGGAAGATCACCCTCTACGAGGACCGGGGCTTCCAGGGCCGCCACTATGAATGCAGCAGCGACCACCCCAACCTGCAGCCCTACTTGAGCCGCTGCAACTCGGCGCGCGTGGACAGCGGCTGCTGGATGCTCTATGAGCAGCCCAACTACTCGGGCCTCCAGTACTTCCTGCGCCGCGGCGACTATGCCGACCACCAGCAGTGGATGGGCCTCAGCGACTCGGTCCGCTCCTGCCGCCTCATCCCCCACTCTGGCTCTCACAGGATCAGACTCTATGAGAGAGAGGACTACAGAGGCCAGATGATAGAGTTCACTGAGGACTGCTCCTGTCTTCAGGACCGCTTCCGCTTCAATGAAATCCACTCCCTCAACGTGCTGGAGGGCTCCTGGGTCCTCTACGAGCTGTCCAACTACCGAGGACGGCAGTACCTGCTGATGCCAGGGGACTATAGGCGCTACCAGGACTGGGGGGCCACGAATGCCAGAGTGGGCTCTCTGAGGAGAGTCATAGATTTCTCCTGA
ORF Protein Sequence MGKITLYEDRGFQGRHYECSSDHPNLQPYLSRCNSARVDSGCWMLYEQPNYSGLQYFLRRGDYADHQQWMGLSDSVRSCRLIPHSGSHRIRLYEREDYRGQMIEFTEDCSCLQDRFRFNEIHSLNVLEGSWVLYELSNYRGRQYLLMPGDYRRYQDWGATNARVGSLRRVIDFS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2439-Ab Anti-CRYGD monoclonal antibody
    Target Antigen GM-Tg-g-IP2439-Ag CRYGD protein
    ORF Viral Vector pGMLP003419 Human CRYGD Lentivirus plasmid
    ORF Viral Vector vGMLP003419 Human CRYGD Lentivirus particle


    Target information

    Target ID GM-IP2439
    Target Name CRYGD
    Gene Group Identifier
    （Target Gene ID in Homo species)         		1421
    Gene ID 1421 (Homo sapiens)
    Gene Symbols & Synonyms CRYGD,CCP,PCC,CACA,CCA3,CRYG4,CTRCT4,cry-g-D
    Target Alternative Names CACA,CCA3,CCP,CRYG4,CRYGD,CTRCT4,Gamma-D-crystallin,Gamma-crystallin 4,Gamma-crystallin D,PCC,cry-g-D
    Uniprot Accession P07320
    Additional SwissProt Accessions: P07320
    Uniprot Entry Name
    Protein Sub-location Introcelluar Protein
    Category Diagnostics Biomarker
    Disease
    Disease from KEGG
    Gene Ensembl ENSG00000118231
    Target Classification


    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.